ID: 989120949

View in Genome Browser
Species Human (GRCh38)
Location 5:38004054-38004076
Sequence AACATGCATGGCTGCTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120947_989120949 -4 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120941_989120949 24 Left 989120941 5:38004007-38004029 CCCTAGCCCATCAGAGGTCAGAT No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120942_989120949 23 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120943_989120949 18 Left 989120943 5:38004013-38004035 CCCATCAGAGGTCAGATTATCCC No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120946_989120949 -3 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120945_989120949 -2 Left 989120945 5:38004033-38004055 CCCCTCTCTGAGTTGTCTAAGAA No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120944_989120949 17 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120940_989120949 25 Left 989120940 5:38004006-38004028 CCCCTAGCCCATCAGAGGTCAGA No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120949 Original CRISPR AACATGCATGGCTGCTTCCC TGG Intergenic