ID: 989120951

View in Genome Browser
Species Human (GRCh38)
Location 5:38004056-38004078
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120945_989120951 0 Left 989120945 5:38004033-38004055 CCCCTCTCTGAGTTGTCTAAGAA No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120940_989120951 27 Left 989120940 5:38004006-38004028 CCCCTAGCCCATCAGAGGTCAGA No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120946_989120951 -1 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120942_989120951 25 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120944_989120951 19 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120943_989120951 20 Left 989120943 5:38004013-38004035 CCCATCAGAGGTCAGATTATCCC No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120941_989120951 26 Left 989120941 5:38004007-38004029 CCCTAGCCCATCAGAGGTCAGAT No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120947_989120951 -2 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type