ID: 989120953

View in Genome Browser
Species Human (GRCh38)
Location 5:38004066-38004088
Sequence TGCTTCCCTGGGGGCTTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120947_989120953 8 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data
989120944_989120953 29 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data
989120943_989120953 30 Left 989120943 5:38004013-38004035 CCCATCAGAGGTCAGATTATCCC No data
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data
989120945_989120953 10 Left 989120945 5:38004033-38004055 CCCCTCTCTGAGTTGTCTAAGAA No data
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data
989120946_989120953 9 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC No data
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120953 Original CRISPR TGCTTCCCTGGGGGCTTCCT CGG Intergenic