ID: 989120954

View in Genome Browser
Species Human (GRCh38)
Location 5:38004071-38004093
Sequence CGCAACCGAGGAAGCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120954_989120961 13 Left 989120954 5:38004071-38004093 CCCTGGGGGCTTCCTCGGTTGCG No data
Right 989120961 5:38004107-38004129 CTCTCTTCTAAGTGTATTATAGG No data
989120954_989120962 14 Left 989120954 5:38004071-38004093 CCCTGGGGGCTTCCTCGGTTGCG No data
Right 989120962 5:38004108-38004130 TCTCTTCTAAGTGTATTATAGGG No data
989120954_989120960 -10 Left 989120954 5:38004071-38004093 CCCTGGGGGCTTCCTCGGTTGCG No data
Right 989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120954 Original CRISPR CGCAACCGAGGAAGCCCCCA GGG (reversed) Intergenic