ID: 989120956

View in Genome Browser
Species Human (GRCh38)
Location 5:38004072-38004094
Sequence CCTGGGGGCTTCCTCGGTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120945_989120956 16 Left 989120945 5:38004033-38004055 CCCCTCTCTGAGTTGTCTAAGAA No data
Right 989120956 5:38004072-38004094 CCTGGGGGCTTCCTCGGTTGCGG No data
989120946_989120956 15 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC No data
Right 989120956 5:38004072-38004094 CCTGGGGGCTTCCTCGGTTGCGG No data
989120947_989120956 14 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120956 5:38004072-38004094 CCTGGGGGCTTCCTCGGTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120956 Original CRISPR CCTGGGGGCTTCCTCGGTTG CGG Intergenic