ID: 989120960

View in Genome Browser
Species Human (GRCh38)
Location 5:38004084-38004106
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120947_989120960 26 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG No data
989120945_989120960 28 Left 989120945 5:38004033-38004055 CCCCTCTCTGAGTTGTCTAAGAA No data
Right 989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG No data
989120946_989120960 27 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG No data
989120954_989120960 -10 Left 989120954 5:38004071-38004093 CCCTGGGGGCTTCCTCGGTTGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type