ID: 989121395

View in Genome Browser
Species Human (GRCh38)
Location 5:38008049-38008071
Sequence GAGACTCCTGAAATGATTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989121395_989121401 -4 Left 989121395 5:38008049-38008071 CCCCTAATCATTTCAGGAGTCTC No data
Right 989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989121395 Original CRISPR GAGACTCCTGAAATGATTAG GGG (reversed) Intergenic
No off target data available for this crispr