ID: 989121401

View in Genome Browser
Species Human (GRCh38)
Location 5:38008068-38008090
Sequence TCTCAGGGCTTGGCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989121397_989121401 -6 Left 989121397 5:38008051-38008073 CCTAATCATTTCAGGAGTCTCAG No data
Right 989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG No data
989121395_989121401 -4 Left 989121395 5:38008049-38008071 CCCCTAATCATTTCAGGAGTCTC No data
Right 989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG No data
989121392_989121401 28 Left 989121392 5:38008017-38008039 CCTGTCCACAGTTGGGCTGAATT No data
Right 989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG No data
989121393_989121401 23 Left 989121393 5:38008022-38008044 CCACAGTTGGGCTGAATTTTCTG No data
Right 989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG No data
989121391_989121401 29 Left 989121391 5:38008016-38008038 CCCTGTCCACAGTTGGGCTGAAT No data
Right 989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG No data
989121396_989121401 -5 Left 989121396 5:38008050-38008072 CCCTAATCATTTCAGGAGTCTCA No data
Right 989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989121401 Original CRISPR TCTCAGGGCTTGGCAGAGAC TGG Intergenic
No off target data available for this crispr