ID: 989123229

View in Genome Browser
Species Human (GRCh38)
Location 5:38025722-38025744
Sequence CTAGCTCTTGCCGATGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989123222_989123229 8 Left 989123222 5:38025691-38025713 CCCAGGCCCTGGCGTGAAGGTGG 0: 1
1: 0
2: 1
3: 20
4: 228
Right 989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62
989123225_989123229 2 Left 989123225 5:38025697-38025719 CCCTGGCGTGAAGGTGGCACTGT 0: 1
1: 0
2: 1
3: 7
4: 181
Right 989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62
989123220_989123229 11 Left 989123220 5:38025688-38025710 CCTCCCAGGCCCTGGCGTGAAGG 0: 1
1: 0
2: 6
3: 22
4: 205
Right 989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62
989123216_989123229 30 Left 989123216 5:38025669-38025691 CCGGTAACCTGCATACAGACCTC No data
Right 989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62
989123224_989123229 7 Left 989123224 5:38025692-38025714 CCAGGCCCTGGCGTGAAGGTGGC 0: 1
1: 0
2: 0
3: 21
4: 232
Right 989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62
989123226_989123229 1 Left 989123226 5:38025698-38025720 CCTGGCGTGAAGGTGGCACTGTG 0: 1
1: 0
2: 0
3: 18
4: 180
Right 989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62
989123218_989123229 23 Left 989123218 5:38025676-38025698 CCTGCATACAGACCTCCCAGGCC No data
Right 989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989123229 Original CRISPR CTAGCTCTTGCCGATGGAAT GGG Intergenic
903085237 1:20851422-20851444 CGAGCTGTTGCAGATGGAAGGGG + Exonic
906295587 1:44647105-44647127 GTAGCTCTTGGAGATGGCATGGG + Intronic
907792086 1:57676820-57676842 CTAGTTCTTGCAGGTTGAATAGG - Intronic
918066404 1:181105000-181105022 CCAGCTCTTGCCGGTGGGCTGGG - Intergenic
921028406 1:211312746-211312768 CAAGCTATTGCAGATGTAATTGG + Exonic
921159507 1:212463155-212463177 CTAGCTCTTGCCACTGGAGCTGG + Intergenic
921343199 1:214154673-214154695 CTAGCACTTGGGGGTGGAATCGG + Intergenic
922115309 1:222607661-222607683 CCAGGTCATGCTGATGGAATAGG + Intergenic
924040242 1:239977619-239977641 CCAGTTCTTGCCAATGGAAGAGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1071296312 10:84222562-84222584 GTTGCTCTTGCCAATGGAGTTGG + Exonic
1076651774 10:131994514-131994536 CCAGCTCTGGCTGATGGAATTGG - Intergenic
1077441692 11:2571929-2571951 CTAGGGCTGGCCGATGGCATGGG - Intronic
1096637741 12:52971818-52971840 CAAGCTCTGGCTGATGGAAGAGG - Intergenic
1098562199 12:71887055-71887077 CTATCTCTTACCTATAGAATAGG - Intronic
1098792147 12:74837322-74837344 CTAGGTCATGCTGATGGAAGAGG - Intergenic
1113592479 13:111510861-111510883 CTAGCTCTGGCTGGTGGAGTGGG + Intergenic
1113726163 13:112603960-112603982 CTAGCTCTTGCTTCTAGAATAGG - Intergenic
1125229488 15:37436502-37436524 CTACCTCTGGCGGATGGAGTTGG + Intergenic
1128341650 15:66826478-66826500 CAAGCTCTTGCCTATTGACTGGG + Intergenic
1135941710 16:26827692-26827714 CTTGCTTTGGCCAATGGAATGGG - Intergenic
1143428786 17:6863292-6863314 GGAGGTCTTGCCCATGGAATGGG - Intergenic
1147594868 17:41710467-41710489 CTAACCATTGCCTATGGAATAGG + Intergenic
1148145509 17:45362144-45362166 CACGTTCTTGCCAATGGAATGGG - Intergenic
1151924516 17:77184772-77184794 CTAGCTCTTTCCATTGGAAGGGG - Intronic
1153129150 18:1834682-1834704 CCAGCTCTGGCCAATGGAATAGG - Intergenic
1159707487 18:71709590-71709612 CAATGTCTTGCCAATGGAATAGG - Intergenic
1165964792 19:39567345-39567367 ATAGCTCTTGTAGAGGGAATAGG + Intergenic
926203399 2:10817591-10817613 CAAGGCCTTGCCAATGGAATGGG + Intronic
932861041 2:75291468-75291490 CTAGCTGCTGCCAATGGAAAGGG + Intergenic
938362605 2:130702283-130702305 AAAGCTCTTGCAAATGGAATTGG - Intergenic
939150184 2:138463140-138463162 CTAGGTCATGCTGATGGAAGAGG + Intergenic
942015034 2:171804897-171804919 CTAGATCTTACGGATGGGATGGG + Intronic
942941754 2:181626833-181626855 CTGGCTCTTGCCTTTGGATTAGG + Intronic
945936297 2:215905964-215905986 CTAGCTCTTGCAGGGGAAATAGG - Intergenic
948429649 2:237911512-237911534 GTAGCTCCTGCGGATGGAAGAGG - Exonic
1168861216 20:1047306-1047328 CTAGCTCTTACCAATAGAATGGG + Intergenic
1171571545 20:26255933-26255955 CAAGCTCTTGCTGATGCAAGAGG - Intergenic
1176418074 21:6491161-6491183 CCAGCTCTAGGAGATGGAATTGG - Intergenic
1179693568 21:43099491-43099513 CCAGCTCTAGGAGATGGAATTGG - Intronic
957144994 3:76412665-76412687 CTAGGTCATGCTGATGGAAGCGG + Intronic
966906750 3:184531728-184531750 CTAGTTCTAGACAATGGAATGGG - Intronic
968498024 4:929181-929203 CAAGCTCTGGCCTAAGGAATGGG - Intronic
986111998 5:4728438-4728460 CTAGCCCTTGGAGATGGAACAGG + Intergenic
987344606 5:16967995-16968017 CTAGTTCTTTCCGATGGTTTTGG - Intergenic
989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG + Intergenic
1000648366 5:163785409-163785431 CTAGGTCATGCTGATGGAAGAGG + Intergenic
1003698884 6:8440298-8440320 CTAGCTCTTCCATAAGGAATAGG + Intergenic
1008147425 6:47908345-47908367 CCAGCTCTTGCCCATGAATTGGG + Intronic
1015096033 6:129416531-129416553 CTGGCTCTGGGCGATGGAACTGG - Intronic
1017223226 6:151990577-151990599 CTAGTTCTTCCCCATGGAATGGG - Intronic
1021001163 7:15331949-15331971 CTAAGTCCTGCCAATGGAATGGG + Intronic
1029389999 7:100268723-100268745 TTAGCTCTTGAGGATTGAATAGG + Intronic
1032476030 7:132212021-132212043 CTAGCTCTTGCTGATGGATGTGG + Intronic
1035578191 8:722123-722145 CTTGCTCTTGCTGCTGGAAGGGG - Intronic
1040729160 8:50421514-50421536 AAAGGTCTTGCTGATGGAATAGG - Intronic
1042805815 8:72769712-72769734 CTTCCTCTTGCCCATAGAATGGG - Intronic
1047851311 8:128860592-128860614 CTTGCTTTGGCCAATGGAATTGG + Intergenic
1052120829 9:24714373-24714395 CCAGGTCTTGCTGATGGAAGAGG + Intergenic
1052251136 9:26398347-26398369 CTTTCCCTTGCTGATGGAATAGG + Intergenic
1053291925 9:36885973-36885995 CTTGCTCTGGCCAATGGGATGGG + Intronic
1056277486 9:85007284-85007306 TTAGCTCTTTCTGATGGCATAGG - Intronic
1186547675 X:10467738-10467760 CTAGCTCTTGCCTGTGAATTAGG + Intronic
1186605874 X:11090655-11090677 CTAAGTCTTGCTGGTGGAATAGG + Intergenic
1195956398 X:110335510-110335532 CTAGGGGTTGCCGATGGCATAGG + Intronic
1199196851 X:145041881-145041903 CAAGGTCTTGCCCATGAAATGGG + Intergenic
1199200925 X:145088112-145088134 CTAGGTCATGCTGATGCAATAGG - Intergenic
1199909715 X:152272286-152272308 CTAGGTCATGCCGATGCAAGAGG - Intronic