ID: 989125859

View in Genome Browser
Species Human (GRCh38)
Location 5:38051868-38051890
Sequence AAGTTTTGAAAGGTGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989125853_989125859 27 Left 989125853 5:38051818-38051840 CCCAAACTCATGCACCTGCCATT No data
Right 989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG No data
989125854_989125859 26 Left 989125854 5:38051819-38051841 CCAAACTCATGCACCTGCCATTG No data
Right 989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG No data
989125855_989125859 13 Left 989125855 5:38051832-38051854 CCTGCCATTGTAGTGAGCATGAC No data
Right 989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG No data
989125856_989125859 9 Left 989125856 5:38051836-38051858 CCATTGTAGTGAGCATGACGTGA No data
Right 989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG No data
989125852_989125859 28 Left 989125852 5:38051817-38051839 CCCCAAACTCATGCACCTGCCAT No data
Right 989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989125859 Original CRISPR AAGTTTTGAAAGGTGCTACA AGG Intergenic
No off target data available for this crispr