ID: 989127976

View in Genome Browser
Species Human (GRCh38)
Location 5:38075289-38075311
Sequence TGGCCACAGCTGCTGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989127976_989127979 15 Left 989127976 5:38075289-38075311 CCAGTGGGCAGCAGCTGTGGCCA No data
Right 989127979 5:38075327-38075349 CTAGCAGCAGGAGATCTGTGTGG No data
989127976_989127980 30 Left 989127976 5:38075289-38075311 CCAGTGGGCAGCAGCTGTGGCCA No data
Right 989127980 5:38075342-38075364 CTGTGTGGTACACTTTCATTTGG No data
989127976_989127978 3 Left 989127976 5:38075289-38075311 CCAGTGGGCAGCAGCTGTGGCCA No data
Right 989127978 5:38075315-38075337 GTTAATTATGCTCTAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989127976 Original CRISPR TGGCCACAGCTGCTGCCCAC TGG (reversed) Intergenic
No off target data available for this crispr