ID: 989129762

View in Genome Browser
Species Human (GRCh38)
Location 5:38095342-38095364
Sequence CTGAGGTTTAGGAGGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989129762_989129770 14 Left 989129762 5:38095342-38095364 CCCTGCCACCTCCTAAACCTCAG No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129762_989129769 13 Left 989129762 5:38095342-38095364 CCCTGCCACCTCCTAAACCTCAG No data
Right 989129769 5:38095378-38095400 GTGGAAATAGAAGTATCCAGTGG No data
989129762_989129768 -6 Left 989129762 5:38095342-38095364 CCCTGCCACCTCCTAAACCTCAG No data
Right 989129768 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data
989129762_989129771 19 Left 989129762 5:38095342-38095364 CCCTGCCACCTCCTAAACCTCAG No data
Right 989129771 5:38095384-38095406 ATAGAAGTATCCAGTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989129762 Original CRISPR CTGAGGTTTAGGAGGTGGCA GGG (reversed) Intergenic
No off target data available for this crispr