ID: 989129763

View in Genome Browser
Species Human (GRCh38)
Location 5:38095343-38095365
Sequence GCTGAGGTTTAGGAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989129763_989129771 18 Left 989129763 5:38095343-38095365 CCTGCCACCTCCTAAACCTCAGC No data
Right 989129771 5:38095384-38095406 ATAGAAGTATCCAGTGGGAGTGG No data
989129763_989129770 13 Left 989129763 5:38095343-38095365 CCTGCCACCTCCTAAACCTCAGC No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129763_989129768 -7 Left 989129763 5:38095343-38095365 CCTGCCACCTCCTAAACCTCAGC No data
Right 989129768 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data
989129763_989129769 12 Left 989129763 5:38095343-38095365 CCTGCCACCTCCTAAACCTCAGC No data
Right 989129769 5:38095378-38095400 GTGGAAATAGAAGTATCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989129763 Original CRISPR GCTGAGGTTTAGGAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr