ID: 989129768

View in Genome Browser
Species Human (GRCh38)
Location 5:38095359-38095381
Sequence CCTCAGCACATCAGCGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989129763_989129768 -7 Left 989129763 5:38095343-38095365 CCTGCCACCTCCTAAACCTCAGC No data
Right 989129768 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data
989129761_989129768 6 Left 989129761 5:38095330-38095352 CCACAGCAGAAACCCTGCCACCT No data
Right 989129768 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data
989129762_989129768 -6 Left 989129762 5:38095342-38095364 CCCTGCCACCTCCTAAACCTCAG No data
Right 989129768 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data
989129759_989129768 14 Left 989129759 5:38095322-38095344 CCACCTCACCACAGCAGAAACCC No data
Right 989129768 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data
989129760_989129768 11 Left 989129760 5:38095325-38095347 CCTCACCACAGCAGAAACCCTGC No data
Right 989129768 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989129768 Original CRISPR CCTCAGCACATCAGCGTCAG TGG Intergenic
No off target data available for this crispr