ID: 989129770

View in Genome Browser
Species Human (GRCh38)
Location 5:38095379-38095401
Sequence TGGAAATAGAAGTATCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989129761_989129770 26 Left 989129761 5:38095330-38095352 CCACAGCAGAAACCCTGCCACCT No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129767_989129770 -3 Left 989129767 5:38095359-38095381 CCTCAGCACATCAGCGTCAGTGG No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129762_989129770 14 Left 989129762 5:38095342-38095364 CCCTGCCACCTCCTAAACCTCAG No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129763_989129770 13 Left 989129763 5:38095343-38095365 CCTGCCACCTCCTAAACCTCAGC No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129765_989129770 6 Left 989129765 5:38095350-38095372 CCTCCTAAACCTCAGCACATCAG No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129764_989129770 9 Left 989129764 5:38095347-38095369 CCACCTCCTAAACCTCAGCACAT No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data
989129766_989129770 3 Left 989129766 5:38095353-38095375 CCTAAACCTCAGCACATCAGCGT No data
Right 989129770 5:38095379-38095401 TGGAAATAGAAGTATCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989129770 Original CRISPR TGGAAATAGAAGTATCCAGT GGG Intergenic
No off target data available for this crispr