ID: 989133459

View in Genome Browser
Species Human (GRCh38)
Location 5:38130190-38130212
Sequence TAACCCACCCCCACCCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989133459_989133461 -4 Left 989133459 5:38130190-38130212 CCTAGATGGGTGGGGGTGGGTTA No data
Right 989133461 5:38130209-38130231 GTTAAAACATGCCCCTGCCTGGG No data
989133459_989133470 30 Left 989133459 5:38130190-38130212 CCTAGATGGGTGGGGGTGGGTTA No data
Right 989133470 5:38130243-38130265 ATAAATTCAATCACAGACTAAGG No data
989133459_989133460 -5 Left 989133459 5:38130190-38130212 CCTAGATGGGTGGGGGTGGGTTA No data
Right 989133460 5:38130208-38130230 GGTTAAAACATGCCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989133459 Original CRISPR TAACCCACCCCCACCCATCT AGG (reversed) Intergenic
No off target data available for this crispr