ID: 989133769

View in Genome Browser
Species Human (GRCh38)
Location 5:38133283-38133305
Sequence CCTGCACAGCACTGCCTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989133767_989133769 6 Left 989133767 5:38133254-38133276 CCAGCAAGTTGGCAGAGCTCAAA No data
Right 989133769 5:38133283-38133305 CCTGCACAGCACTGCCTTGTCGG No data
989133766_989133769 9 Left 989133766 5:38133251-38133273 CCTCCAGCAAGTTGGCAGAGCTC No data
Right 989133769 5:38133283-38133305 CCTGCACAGCACTGCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989133769 Original CRISPR CCTGCACAGCACTGCCTTGT CGG Intergenic
No off target data available for this crispr