ID: 989136598

View in Genome Browser
Species Human (GRCh38)
Location 5:38162054-38162076
Sequence GTGTTGTTGAATGAAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989136598_989136601 26 Left 989136598 5:38162054-38162076 CCTTTGTTTTCATTCAACAACAC No data
Right 989136601 5:38162103-38162125 TTTTTGTGCCAAGTGACAGTGGG No data
989136598_989136600 25 Left 989136598 5:38162054-38162076 CCTTTGTTTTCATTCAACAACAC No data
Right 989136600 5:38162102-38162124 TTTTTTGTGCCAAGTGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989136598 Original CRISPR GTGTTGTTGAATGAAAACAA AGG (reversed) Intergenic
No off target data available for this crispr