ID: 989139404

View in Genome Browser
Species Human (GRCh38)
Location 5:38188527-38188549
Sequence GGTCAGAGTAGAACACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989139404_989139412 25 Left 989139404 5:38188527-38188549 CCAGCCTGTGTTCTACTCTGACC No data
Right 989139412 5:38188575-38188597 CTGCATATTTTCATAACTTTGGG No data
989139404_989139413 26 Left 989139404 5:38188527-38188549 CCAGCCTGTGTTCTACTCTGACC No data
Right 989139413 5:38188576-38188598 TGCATATTTTCATAACTTTGGGG No data
989139404_989139411 24 Left 989139404 5:38188527-38188549 CCAGCCTGTGTTCTACTCTGACC No data
Right 989139411 5:38188574-38188596 TCTGCATATTTTCATAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989139404 Original CRISPR GGTCAGAGTAGAACACAGGC TGG (reversed) Intergenic
No off target data available for this crispr