ID: 989146478

View in Genome Browser
Species Human (GRCh38)
Location 5:38256026-38256048
Sequence GGCGATTTGGGAAATAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146478_989146491 21 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146478_989146488 14 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data
989146478_989146492 30 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146492 5:38256079-38256101 GCCCAGGGCCAGGGATGCCGAGG No data
989146478_989146486 5 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146486 5:38256054-38256076 TCATCTGCAAAAAAATGGAAGGG No data
989146478_989146485 4 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146485 5:38256053-38256075 GTCATCTGCAAAAAAATGGAAGG No data
989146478_989146484 0 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146484 5:38256049-38256071 TATGGTCATCTGCAAAAAAATGG No data
989146478_989146489 15 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146489 5:38256064-38256086 AAAAATGGAAGGGAGGCCCAGGG No data
989146478_989146490 20 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146478_989146487 8 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146487 5:38256057-38256079 TCTGCAAAAAAATGGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146478 Original CRISPR GGCGATTTGGGAAATAGGCT TGG (reversed) Intergenic
No off target data available for this crispr