ID: 989146479

View in Genome Browser
Species Human (GRCh38)
Location 5:38256031-38256053
Sequence CCATAGGCGATTTGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146479_989146490 15 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146479_989146495 28 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146495 5:38256082-38256104 CAGGGCCAGGGATGCCGAGGTGG No data
989146479_989146492 25 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146492 5:38256079-38256101 GCCCAGGGCCAGGGATGCCGAGG No data
989146479_989146485 -1 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146485 5:38256053-38256075 GTCATCTGCAAAAAAATGGAAGG No data
989146479_989146486 0 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146486 5:38256054-38256076 TCATCTGCAAAAAAATGGAAGGG No data
989146479_989146491 16 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146479_989146487 3 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146487 5:38256057-38256079 TCTGCAAAAAAATGGAAGGGAGG No data
989146479_989146489 10 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146489 5:38256064-38256086 AAAAATGGAAGGGAGGCCCAGGG No data
989146479_989146484 -5 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146484 5:38256049-38256071 TATGGTCATCTGCAAAAAAATGG No data
989146479_989146488 9 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146479 Original CRISPR CCATAGGCGATTTGGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr