ID: 989146482

View in Genome Browser
Species Human (GRCh38)
Location 5:38256039-38256061
Sequence GCAGATGACCATAGGCGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146482_989146497 25 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146497 5:38256087-38256109 CCAGGGATGCCGAGGTGGTGTGG No data
989146482_989146495 20 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146495 5:38256082-38256104 CAGGGCCAGGGATGCCGAGGTGG No data
989146482_989146498 26 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146498 5:38256088-38256110 CAGGGATGCCGAGGTGGTGTGGG No data
989146482_989146486 -8 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146486 5:38256054-38256076 TCATCTGCAAAAAAATGGAAGGG No data
989146482_989146488 1 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data
989146482_989146491 8 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146482_989146487 -5 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146487 5:38256057-38256079 TCTGCAAAAAAATGGAAGGGAGG No data
989146482_989146489 2 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146489 5:38256064-38256086 AAAAATGGAAGGGAGGCCCAGGG No data
989146482_989146492 17 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146492 5:38256079-38256101 GCCCAGGGCCAGGGATGCCGAGG No data
989146482_989146490 7 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146482_989146485 -9 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146485 5:38256053-38256075 GTCATCTGCAAAAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146482 Original CRISPR GCAGATGACCATAGGCGATT TGG (reversed) Intergenic
No off target data available for this crispr