ID: 989146483

View in Genome Browser
Species Human (GRCh38)
Location 5:38256047-38256069
Sequence ATTTTTTTGCAGATGACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146483_989146500 27 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146500 5:38256097-38256119 CGAGGTGGTGTGGGCACATGAGG No data
989146483_989146501 30 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146501 5:38256100-38256122 GGTGGTGTGGGCACATGAGGAGG No data
989146483_989146495 12 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146495 5:38256082-38256104 CAGGGCCAGGGATGCCGAGGTGG No data
989146483_989146488 -7 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data
989146483_989146491 0 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146483_989146490 -1 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146483_989146498 18 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146498 5:38256088-38256110 CAGGGATGCCGAGGTGGTGTGGG No data
989146483_989146492 9 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146492 5:38256079-38256101 GCCCAGGGCCAGGGATGCCGAGG No data
989146483_989146489 -6 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146489 5:38256064-38256086 AAAAATGGAAGGGAGGCCCAGGG No data
989146483_989146497 17 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146497 5:38256087-38256109 CCAGGGATGCCGAGGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146483 Original CRISPR ATTTTTTTGCAGATGACCAT AGG (reversed) Intergenic
No off target data available for this crispr