ID: 989146484

View in Genome Browser
Species Human (GRCh38)
Location 5:38256049-38256071
Sequence TATGGTCATCTGCAAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146479_989146484 -5 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146484 5:38256049-38256071 TATGGTCATCTGCAAAAAAATGG No data
989146478_989146484 0 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146484 5:38256049-38256071 TATGGTCATCTGCAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146484 Original CRISPR TATGGTCATCTGCAAAAAAA TGG Intergenic
No off target data available for this crispr