ID: 989146487

View in Genome Browser
Species Human (GRCh38)
Location 5:38256057-38256079
Sequence TCTGCAAAAAAATGGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146479_989146487 3 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146487 5:38256057-38256079 TCTGCAAAAAAATGGAAGGGAGG No data
989146482_989146487 -5 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146487 5:38256057-38256079 TCTGCAAAAAAATGGAAGGGAGG No data
989146481_989146487 -4 Left 989146481 5:38256038-38256060 CCCAAATCGCCTATGGTCATCTG No data
Right 989146487 5:38256057-38256079 TCTGCAAAAAAATGGAAGGGAGG No data
989146478_989146487 8 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146487 5:38256057-38256079 TCTGCAAAAAAATGGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146487 Original CRISPR TCTGCAAAAAAATGGAAGGG AGG Intergenic
No off target data available for this crispr