ID: 989146488

View in Genome Browser
Species Human (GRCh38)
Location 5:38256063-38256085
Sequence AAAAAATGGAAGGGAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146483_989146488 -7 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data
989146479_989146488 9 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data
989146481_989146488 2 Left 989146481 5:38256038-38256060 CCCAAATCGCCTATGGTCATCTG No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data
989146482_989146488 1 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data
989146478_989146488 14 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146488 5:38256063-38256085 AAAAAATGGAAGGGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146488 Original CRISPR AAAAAATGGAAGGGAGGCCC AGG Intergenic
No off target data available for this crispr