ID: 989146490

View in Genome Browser
Species Human (GRCh38)
Location 5:38256069-38256091
Sequence TGGAAGGGAGGCCCAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146479_989146490 15 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146481_989146490 8 Left 989146481 5:38256038-38256060 CCCAAATCGCCTATGGTCATCTG No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146478_989146490 20 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146482_989146490 7 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data
989146483_989146490 -1 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146490 5:38256069-38256091 TGGAAGGGAGGCCCAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146490 Original CRISPR TGGAAGGGAGGCCCAGGGCC AGG Intergenic
No off target data available for this crispr