ID: 989146491

View in Genome Browser
Species Human (GRCh38)
Location 5:38256070-38256092
Sequence GGAAGGGAGGCCCAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989146478_989146491 21 Left 989146478 5:38256026-38256048 CCAAGCCTATTTCCCAAATCGCC No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146479_989146491 16 Left 989146479 5:38256031-38256053 CCTATTTCCCAAATCGCCTATGG No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146481_989146491 9 Left 989146481 5:38256038-38256060 CCCAAATCGCCTATGGTCATCTG No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146483_989146491 0 Left 989146483 5:38256047-38256069 CCTATGGTCATCTGCAAAAAAAT No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data
989146482_989146491 8 Left 989146482 5:38256039-38256061 CCAAATCGCCTATGGTCATCTGC No data
Right 989146491 5:38256070-38256092 GGAAGGGAGGCCCAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989146491 Original CRISPR GGAAGGGAGGCCCAGGGCCA GGG Intergenic
No off target data available for this crispr