ID: 989149459

View in Genome Browser
Species Human (GRCh38)
Location 5:38284165-38284187
Sequence CTTGGCTTGCCTCTCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989149459 Original CRISPR CTTGGCTTGCCTCTCATTGT TGG Intronic
901177499 1:7315309-7315331 CTTGGCCTGACTCTATTTGTCGG + Intronic
902292457 1:15444445-15444467 CTTGGCTTGCCTCTTGATGAAGG + Intronic
905096574 1:35477045-35477067 CTTTGGTTGCCTGTCCTTGTGGG - Intronic
905385532 1:37601029-37601051 CTTGGCATGCATCTCACTGCTGG + Intergenic
907952261 1:59195112-59195134 CTTGGCCTGCCTCCCATAGTGGG + Intergenic
908254338 1:62290587-62290609 CTTTCCTTGCTTCACATTGTGGG - Intronic
910725306 1:90331799-90331821 CTTTGGTTGCCTCTGCTTGTGGG - Intergenic
911927705 1:103856936-103856958 CTTTGCTTGCCTGTGCTTGTTGG - Intergenic
912848281 1:113097400-113097422 CTTGTTTTCCCTCTCATTGATGG - Intronic
915470291 1:156121852-156121874 CTTGCCTTGCCCCTTATTGAGGG - Intronic
916722462 1:167494783-167494805 ATTGTCTTGCCTCTCATGCTTGG - Intronic
917027452 1:170659708-170659730 CTGGGCTTGGCTCACGTTGTAGG - Intergenic
917559023 1:176125285-176125307 CTTTGGTTGCCTGTGATTGTGGG + Intronic
919223858 1:194667812-194667834 CTTTGTTTGCCTGTGATTGTGGG - Intergenic
919618411 1:199835958-199835980 CCTTCTTTGCCTCTCATTGTGGG - Intergenic
921942518 1:220856903-220856925 CTTTGGTTGCCTGTGATTGTGGG + Intergenic
1067546074 10:47193465-47193487 CTTGGGTTCTCTCTCACTGTTGG + Intergenic
1070745456 10:78931066-78931088 ATTGGCTGGGCTCTCAATGTGGG + Intergenic
1077234190 11:1472067-1472089 CTGGGTTTGCCTCTTACTGTTGG + Intronic
1078083763 11:8221598-8221620 CTGGGCTTGGCTCTCCTTGGGGG - Intergenic
1078308681 11:10217027-10217049 CTTTCCTTGCCTTTCATAGTAGG + Intronic
1078405897 11:11069670-11069692 CAAGCCTGGCCTCTCATTGTGGG + Intergenic
1078852967 11:15180657-15180679 ATTGGCCTCCCTCTCATGGTAGG + Intronic
1079016920 11:16876712-16876734 CTAGCCTTGTCTGTCATTGTAGG - Intronic
1080065565 11:28008485-28008507 CTTGGCAAGGCTGTCATTGTAGG - Intergenic
1080097174 11:28422807-28422829 CTTTGGTTGCCTGTCCTTGTGGG - Intergenic
1081287729 11:41292122-41292144 CTTGTCTCGCCTTTCATAGTGGG + Intronic
1085444871 11:76593809-76593831 CTTGGCTTGCCTGTTTTTGGTGG - Intergenic
1086340107 11:85840317-85840339 CTTTGCTTGCCTGTGCTTGTGGG + Intergenic
1087416836 11:97867289-97867311 CTTTGCTTGCCTGTGCTTGTGGG + Intergenic
1089741974 11:120590752-120590774 CTTGGCTAGCCTTTCATTTGTGG + Intronic
1089778922 11:120859549-120859571 CCTGGCTTCCTTATCATTGTGGG - Intronic
1090317848 11:125811842-125811864 CTTTGCTTGCCTGTGCTTGTGGG + Intergenic
1094833737 12:34312596-34312618 CTTGGCTTTCTTATCATTTTGGG + Intergenic
1096752836 12:53773299-53773321 CTTGGGTTGCCTCTCCCTTTTGG - Intergenic
1098526406 12:71492015-71492037 CTTGGATTGCCTCTAACTTTAGG + Intronic
1102096673 12:110246750-110246772 CCTGGCTTGCCTCTCCCTGGGGG + Intergenic
1106689187 13:32095692-32095714 CTTGGGTTGCCTGTGCTTGTGGG + Intronic
1113468051 13:110525740-110525762 CTTGGCGTGCTTTTCATCGTTGG + Intronic
1115200223 14:30845184-30845206 CTTTGCTTGCCTGTGCTTGTGGG + Intergenic
1115446245 14:33493581-33493603 CTTTGCTTGCCTCTCACAGCGGG - Intronic
1115924997 14:38422881-38422903 CTTTGGTTGCCTCTGCTTGTGGG + Intergenic
1117493744 14:56279505-56279527 CTTGGCTTGTCTGTGATTGACGG + Intronic
1120124984 14:80731149-80731171 CCTGGCTTTCCTCACTTTGTTGG - Intronic
1124147831 15:27145094-27145116 CTTGGTTTGTCTCACAATGTTGG - Intronic
1124553496 15:30705435-30705457 CTTGGCTTGGCTCTTTCTGTTGG - Intronic
1124677749 15:31700233-31700255 CTTGGCTTGGCTCTTTCTGTTGG + Intronic
1124829942 15:33138509-33138531 CTTGTCTAACCTCTCAATGTGGG + Intronic
1124847012 15:33301105-33301127 ATTGGGTTTCCTCCCATTGTTGG + Intergenic
1130096944 15:80862932-80862954 CTTGGCTTACCTTTTATCGTGGG + Intronic
1130652972 15:85772764-85772786 CCTGGGTTGCCGCTCACTGTTGG - Intronic
1135904994 16:26503550-26503572 CTTGGATGGCTTCTGATTGTTGG - Intergenic
1137768564 16:50996484-50996506 CTTGGCTCCCCTGTCCTTGTGGG + Intergenic
1138844603 16:60550248-60550270 CTTGGGTTGCCTGTGTTTGTGGG + Intergenic
1141198408 16:81878800-81878822 CTTATCTTGCCTCTCACTGTTGG + Intronic
1141575225 16:84959215-84959237 CGGGCCTTGCCTGTCATTGTGGG - Intergenic
1142927571 17:3254156-3254178 CTTTGGTTGCCTCTGCTTGTGGG - Intergenic
1144462538 17:15469521-15469543 CTTGCCTGGCCTTTGATTGTTGG + Intronic
1145014740 17:19388814-19388836 CTGTGCTTGCCACTCCTTGTGGG - Intergenic
1147022022 17:37542584-37542606 AATTGCTTGCCTCTAATTGTGGG - Intronic
1147585945 17:41654149-41654171 CTTGGCTTGCATGTCCTTGCTGG - Intergenic
1148032204 17:44629043-44629065 CTTGGCTTGGCTTTCCTTGGGGG - Intergenic
1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG + Intronic
1149400300 17:56289174-56289196 CTTCACTTGCCTCTCATTAATGG - Intronic
1149588562 17:57810656-57810678 CTTGGCTTGCCTGTGGGTGTGGG + Intergenic
1152647533 17:81476431-81476453 CTTGGCCTGCCTCTTGCTGTGGG + Intergenic
1152838850 17:82553402-82553424 CTGTGCTTGCCTCTCAGAGTGGG + Intronic
1153426176 18:4966751-4966773 CTTTGTTTGCCTGTCCTTGTGGG - Intergenic
1153604439 18:6817670-6817692 CTTGGCTTTTCTCTCATAATGGG + Intronic
1154181856 18:12145235-12145257 GTTGGCCTGCCTCTCCTTCTGGG + Intergenic
1155251747 18:23959464-23959486 TGAGGCTTTCCTCTCATTGTGGG - Intergenic
1156089723 18:33452347-33452369 CTTGGCTTGCTCCTGATTTTGGG - Intergenic
1159838121 18:73365419-73365441 TTTCACTTACCTCTCATTGTTGG + Intergenic
1162664456 19:12197953-12197975 CTTTGCTTGCCTGTGCTTGTTGG + Intergenic
1164634124 19:29780255-29780277 CTGGCCTTTTCTCTCATTGTAGG + Intergenic
1165113965 19:33518014-33518036 CTTGGCTGGCCTCTCCTACTGGG - Intronic
1165449492 19:35873936-35873958 CTTGACTTGCCTCTCAGGGCTGG + Intronic
1167784540 19:51626388-51626410 CTTGGGTTGCCTCTGCTTCTTGG - Intronic
926922303 2:17951273-17951295 CTTGGGTTGCCTCTGATTTTTGG + Intronic
929060466 2:37919084-37919106 CCTGGCTCCCCTCTCATTTTAGG - Intergenic
931645958 2:64422107-64422129 CTTGGCTTGAATCACATGGTAGG - Intergenic
932067871 2:68585762-68585784 CTCTGCTTGCTTTTCATTGTTGG - Intronic
943484280 2:188459673-188459695 CTTGGGTTGCCTGTACTTGTGGG + Intronic
945771414 2:214047654-214047676 CTTCGCTTGCCTTTGCTTGTAGG - Intronic
945977772 2:216283895-216283917 CATGGTTTGGCTCTCATGGTGGG - Intronic
946710534 2:222500468-222500490 CTTAGTTTGCCACACATTGTTGG + Intronic
1169011584 20:2255692-2255714 CTTGGCTTGTTTCTTTTTGTTGG + Intergenic
1169043449 20:2516279-2516301 CCAGGCTGGCCTCTAATTGTTGG - Intronic
1171326683 20:24300620-24300642 CTTGGCTTGCCTCTCCTGGTGGG + Intergenic
1171483362 20:25469406-25469428 CCTGTCTTGACTCTCATTGGTGG + Intronic
1173327120 20:42044145-42044167 CTTGGCTTACCCCTCCTTCTGGG - Intergenic
1173455135 20:43195759-43195781 CTTGGGTGACCTCTCAGTGTGGG - Intergenic
1175301778 20:57948079-57948101 TTTGGCTTGGCTTTCACTGTGGG + Intergenic
1177595257 21:23231953-23231975 CTTTGGTTGCCTCTGCTTGTGGG - Intergenic
1179878524 21:44283779-44283801 CTTGGCTTTCCTCTCCTTTGAGG - Intergenic
1182718573 22:32378908-32378930 CTTTCCTAGCCTCTCATTCTAGG - Intronic
1183021851 22:35033702-35033724 CTTGGCTTTCCTCACATTCTTGG - Intergenic
1183539161 22:38419596-38419618 CTTGGCCTCCTTCTCACTGTGGG + Intergenic
1184014204 22:41773375-41773397 CTTGGTTTGCTTCACATAGTGGG + Intronic
949291396 3:2470741-2470763 CCTGGCCTGCCTCTCGTTTTAGG + Intronic
950211689 3:11127933-11127955 CATGGCTTGCTTGTCATTGGTGG + Intergenic
950498616 3:13349512-13349534 CTTGGCTGGCCTCTCTTAGCAGG - Intronic
953454653 3:43032048-43032070 CTTGGCTTGCTTTTCCTTCTAGG - Intronic
953957784 3:47244924-47244946 TTTGGCTGGCCTCTCTATGTAGG - Exonic
955883915 3:63577385-63577407 ATTGGCTTTCCTCTCCATGTGGG - Intronic
956477647 3:69640103-69640125 CTTGGCTTGAATGTCATTGGGGG - Intergenic
957925883 3:86810707-86810729 CTTTGATTGCCTCTGCTTGTGGG - Intergenic
959328341 3:104968274-104968296 CTTTGCTTGCCTGTTCTTGTGGG + Intergenic
960151839 3:114257329-114257351 CTTGGGTTGCCTGTGCTTGTGGG + Intergenic
966679697 3:182628686-182628708 CTTTGGTTGCCTCTGCTTGTGGG + Intergenic
968538722 4:1151345-1151367 CTTGGCTTCCCTCCTATTCTCGG + Intergenic
969121435 4:4914293-4914315 CCTGGCTTTTCTCTCATTGTTGG - Intergenic
970357824 4:15274873-15274895 CTTTGGTTGCCTGTCCTTGTGGG - Intergenic
972014275 4:34224712-34224734 CTTGGGTTGCCTTTGTTTGTGGG + Intergenic
975054006 4:69905020-69905042 CTTTGCTTGCCTGTGCTTGTGGG - Intergenic
975373256 4:73612738-73612760 CTTGGCTGGAGTCTCATTTTAGG + Intronic
975612810 4:76218192-76218214 CTTGGCTTTCTTCTTATTGAAGG + Intronic
977474033 4:97481906-97481928 CTTGTCTTGCTTCTCATTTGAGG + Intronic
977723852 4:100271287-100271309 CTTGGCATGACTGTCATTCTGGG + Intergenic
978261965 4:106770638-106770660 CTTTGGTTGCCTGTGATTGTGGG - Intergenic
980413380 4:132452662-132452684 CTTTGCTTGCCTGTGCTTGTGGG - Intergenic
980557990 4:134433873-134433895 CTTGATTTGCTTCTCATTATTGG - Intergenic
982682938 4:158453937-158453959 CTTTGGTTGCCTGTGATTGTGGG + Intronic
984138569 4:175973682-175973704 CCTGGCTAGCCTCTCAGTGGAGG + Intronic
987499232 5:18685550-18685572 CTTGCCTTGTGTCTAATTGTAGG + Intergenic
989149459 5:38284165-38284187 CTTGGCTTGCCTCTCATTGTTGG + Intronic
989647299 5:43649215-43649237 TTTGGCTTGGCTGGCATTGTGGG + Exonic
990200236 5:53364476-53364498 CTTGGCTTGCCTCCCTCTGTAGG + Intergenic
993536115 5:89088202-89088224 CTAGGATTGCTTCTCATAGTCGG - Intergenic
996127895 5:119747628-119747650 CTTGCCCTGCCTCTCACTTTTGG + Intergenic
1000230325 5:159310006-159310028 TTAGGATTGCCTCTCCTTGTTGG + Intergenic
1002509292 5:179702603-179702625 CTTGGGTTGCTTCTGACTGTTGG + Intronic
1002874146 6:1196465-1196487 CTTGACTTCCCTCTCCTTGACGG - Intergenic
1003770645 6:9295484-9295506 CTTTGCTTGTCTATTATTGTTGG + Intergenic
1003897846 6:10624379-10624401 TTTTGCTTGGCTCTCATTCTTGG - Intronic
1004254353 6:14049377-14049399 GTTGTGTTTCCTCTCATTGTAGG - Intergenic
1005413428 6:25575340-25575362 TTTTGCTTGCCTGTCATTTTAGG + Intronic
1006071637 6:31501462-31501484 CTTTGGTTGCCTCTGCTTGTGGG + Intronic
1006898922 6:37487575-37487597 CTTGGTTTGCGTGTCATTCTGGG + Intronic
1007350401 6:41269255-41269277 CTTCGGTTGCTTCTCATTGGTGG - Intronic
1007379322 6:41477143-41477165 CTTGGCTTCACTGACATTGTTGG + Intergenic
1007421852 6:41724446-41724468 CTGGGCTTCCCTCACATTGCTGG - Intronic
1009402319 6:63271436-63271458 CAAGGGGTGCCTCTCATTGTTGG - Intergenic
1009824068 6:68844133-68844155 CTTTGGTTGCCTCTACTTGTGGG - Intronic
1010775967 6:79886199-79886221 CTTTGGTTGCCTGTGATTGTGGG - Intergenic
1014235534 6:118950208-118950230 CTTTGATTGCCTCTGCTTGTGGG - Intergenic
1014747102 6:125213503-125213525 TTTGCCTTGGCTCTCATTGGAGG + Intronic
1018492702 6:164311515-164311537 CTTGTCTTGCCCCTGATTTTAGG - Intergenic
1020941758 7:14548377-14548399 CTGGGCTTGCCACTCATTTGGGG - Intronic
1020967855 7:14895089-14895111 CTTCTCTTGCCTGTCATTTTGGG - Intronic
1022390922 7:29943822-29943844 TTTGGCATGCCTCTCATTTCTGG - Intronic
1023004247 7:35846271-35846293 CTTAGCCTGCCTCCCATTGTTGG + Intronic
1024744824 7:52394001-52394023 TTAGGCTTGGCACTCATTGTAGG - Intergenic
1028367786 7:90054522-90054544 CTTGGCTTTCATCTCATTTATGG - Intergenic
1030473138 7:109993303-109993325 TTTGACTTGCCTCTCATCCTGGG + Intergenic
1030982342 7:116200936-116200958 CTTGGCTTGCCTTTCCTGATTGG - Intergenic
1035343749 7:158183766-158183788 CTTTGCTTGGCTCACAGTGTAGG + Intronic
1037294555 8:17386601-17386623 CTTGGCTGGGCCCTCATTGCTGG + Intronic
1043829896 8:84975103-84975125 CTTTGCTTGCCTGTGCTTGTGGG - Intergenic
1045991294 8:108311566-108311588 CTTTGCTTGCCTGTGCTTGTAGG - Intronic
1050227808 9:3480651-3480673 CGTAGATTGACTCTCATTGTGGG - Intronic
1052252926 9:26421320-26421342 CTTGGCTTGCAGCTCTTTTTTGG - Intergenic
1052539257 9:29786863-29786885 CTTTGCTTGCCTGTGCTTGTGGG - Intergenic
1053067329 9:35077967-35077989 CCTGGTTGGTCTCTCATTGTGGG - Intronic
1056626165 9:88255171-88255193 CTTGGGTTCCCTCTCAGTCTGGG - Intergenic
1058821658 9:108737021-108737043 CTTTGCTTGCCTATGCTTGTGGG - Intergenic
1058960589 9:109989290-109989312 CTTGCCTTGCCATTCATTGTTGG - Intronic
1060154423 9:121309276-121309298 CTTGGCTTGCTTCTGAGTGAGGG + Intronic
1061378338 9:130239371-130239393 CATCGCCTGCCTCTCATTGAGGG - Intergenic
1061958381 9:133975368-133975390 CTTGGCTTACCTCCCATCTTGGG + Intronic
1062471924 9:136709905-136709927 CTTGGCCTGGCTCACATTGACGG + Intergenic
1187651593 X:21414590-21414612 CTTTGGTTGCCTGTGATTGTGGG + Intronic
1188931560 X:36117772-36117794 CTTCGGTTGCCTGTGATTGTGGG + Intronic
1189011181 X:37047142-37047164 CTTGGATTGCCTTTCCTGGTAGG + Intergenic
1189881088 X:45493005-45493027 CTTTGCTTGCCTGTACTTGTGGG + Intergenic
1191909539 X:66133824-66133846 CTTTGATTGCCTCTGCTTGTGGG + Intergenic
1192760201 X:74088457-74088479 AATGGCTTGCCTCTCCCTGTGGG - Intergenic
1193915867 X:87362983-87363005 CTTTGGTTGCCTTTCCTTGTGGG - Intergenic
1193921214 X:87428937-87428959 CTTTGCTTGCATCTCATTTATGG + Intergenic
1195241250 X:102954541-102954563 CTTGACTTGGCTCTCAGAGTTGG + Intergenic
1195641687 X:107182649-107182671 CTTGGCTTGACTCTGCTTCTAGG - Intronic
1195871022 X:109485918-109485940 CTTGGCTTTACTTTCAGTGTGGG - Intergenic
1197828155 X:130612832-130612854 CTGTGCTTGCCTTTCTTTGTTGG + Intergenic
1197943456 X:131813608-131813630 CTTTGGTTTCCTCTCACTGTGGG + Intergenic
1198190958 X:134305210-134305232 CTTGGGTTGCCTGTGCTTGTGGG - Intergenic
1198946619 X:142023157-142023179 CTTTGCTTGCCTGTGATTGCAGG + Intergenic