ID: 989149866

View in Genome Browser
Species Human (GRCh38)
Location 5:38288793-38288815
Sequence GAAGCAGTTGCTCAACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989149866_989149871 22 Left 989149866 5:38288793-38288815 CCAAATTGTTGAGCAACTGCTTC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 989149871 5:38288838-38288860 GTGTTGTTTCTTCAATATTGGGG No data
989149866_989149870 21 Left 989149866 5:38288793-38288815 CCAAATTGTTGAGCAACTGCTTC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 989149870 5:38288837-38288859 TGTGTTGTTTCTTCAATATTGGG 0: 1
1: 0
2: 3
3: 31
4: 368
989149866_989149869 20 Left 989149866 5:38288793-38288815 CCAAATTGTTGAGCAACTGCTTC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 989149869 5:38288836-38288858 ATGTGTTGTTTCTTCAATATTGG No data
989149866_989149872 25 Left 989149866 5:38288793-38288815 CCAAATTGTTGAGCAACTGCTTC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 989149872 5:38288841-38288863 TTGTTTCTTCAATATTGGGGTGG 0: 1
1: 0
2: 3
3: 23
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989149866 Original CRISPR GAAGCAGTTGCTCAACAATT TGG (reversed) Intronic
905918457 1:41702147-41702169 CAAGCAGAAGCTCAACAAATGGG + Intronic
906845406 1:49186144-49186166 GGAGCATTTGCTCAACAAGCTGG - Intronic
906901205 1:49838080-49838102 AAACTAGTTGCTCAACTATTGGG + Intronic
909780738 1:79543203-79543225 GAACCACCTGCTAAACAATTAGG + Intergenic
911152368 1:94607977-94607999 GTAGCAGGTGCTCAATTATTAGG + Intergenic
912782457 1:112564554-112564576 GGAGCAGTGGCTCAGCACTTTGG + Intronic
916071150 1:161170704-161170726 GAAGCAGCTGCTACACAATTAGG + Exonic
916645072 1:166776839-166776861 GAAGTAGTTGATCAAGAAATGGG - Intergenic
919028484 1:192207444-192207466 TAAGTAGTTTCTCAACAACTGGG - Intergenic
922352626 1:224746745-224746767 GAAGCAGTTGCTTCCCAATGAGG + Intergenic
922522016 1:226261997-226262019 AAGGCAGTTGCGCAACAAATGGG + Intronic
1068071173 10:52197932-52197954 GAAGCAGTTGATTTACAATATGG + Intronic
1069843753 10:71356354-71356376 AAAGCAGTTGTTCAACAAATAGG + Intronic
1072028602 10:91492651-91492673 GAATCAACTGATCAACAATTCGG - Intronic
1073974520 10:109085877-109085899 GTGCCAGTTGCTCAACCATTGGG + Intergenic
1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG + Intergenic
1075277169 10:121104639-121104661 GAAGCAGCTGCTCAACTAGCTGG + Intergenic
1076284824 10:129284353-129284375 AAACCAGTTGCTCTACAACTTGG - Intergenic
1080268778 11:30428178-30428200 TAAGCAGGTGCTCAATAATGTGG - Intronic
1081318979 11:41667414-41667436 GCAGCAGCTGCTGAATAATTAGG + Intergenic
1081508084 11:43739003-43739025 ACAGCAGTTGCTCACCAATCAGG - Intronic
1084272446 11:68036515-68036537 GGAGAAGTTGCTCAACAACGGGG + Exonic
1084951678 11:72669793-72669815 GAAGCAGTGGCTGAAGAATGTGG - Intronic
1087565489 11:99851520-99851542 GTAGCAGTTTCTCCACAGTTGGG + Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095820000 12:46467682-46467704 GAAGCAATTTATCAACACTTTGG - Intergenic
1112217363 13:97446889-97446911 GATGCTGTGGGTCAACAATTTGG - Intronic
1112721007 13:102245017-102245039 AAAGCAGTTGCTCTCCATTTAGG + Intronic
1115124828 14:29979497-29979519 GATGCAGTTTTTCAACAACTAGG + Intronic
1115327245 14:32153807-32153829 GATGCGGTGGCTCAACACTTTGG + Intronic
1115714984 14:36093669-36093691 GAAGCAGTTTCTCAACTACAGGG + Intergenic
1116620522 14:47197264-47197286 GGAGCCCTTGGTCAACAATTAGG + Intronic
1118735951 14:68702173-68702195 GAAGCAGCAGCTCTACAATGGGG - Intronic
1121989961 14:98547223-98547245 GAAGAAATTGCTCTACATTTGGG + Intergenic
1122995371 14:105261027-105261049 GAAGCAGCTGCTCAGCAAAAGGG - Intronic
1125790852 15:42364771-42364793 GAAGCCCTTGCTCAGCAAGTTGG - Intronic
1128031437 15:64484226-64484248 GAAGCATAATCTCAACAATTTGG - Intronic
1129625296 15:77191669-77191691 GAAGGAGTTGCTGAGCAATAAGG + Intronic
1131074270 15:89485125-89485147 GAAGCAGTTGTTCAGCAAGTTGG - Intronic
1134006410 16:10821332-10821354 GAAGCCGTTGCAGAACATTTAGG + Intergenic
1134468405 16:14499401-14499423 AAAGCAGTTCCTCAGCAAATGGG - Intronic
1136368312 16:29820127-29820149 GTAGCTGTAGCTCAACAGTTAGG + Exonic
1138204222 16:55113280-55113302 GCAGGAGTTGCTCAGCAAATGGG - Intergenic
1138507335 16:57484974-57484996 GAAGGAGATGCTCAATATTTGGG + Intronic
1145886138 17:28383836-28383858 GAAGGAGGTGCTAATCAATTTGG + Intronic
1146268730 17:31470591-31470613 GAAGCAGGTGCTTAACACATGGG + Intronic
1151377517 17:73700544-73700566 GAAGCAGTTCCTCATCTGTTTGG + Intergenic
1151764810 17:76127329-76127351 GAGGCAGTTGGTCAACTATTGGG - Intergenic
1155821113 18:30378452-30378474 AAAACAGTTGCTCCACCATTTGG - Intergenic
1162991116 19:14302802-14302824 GAAGCAGTTCTTCAGCAATGGGG - Intergenic
1164639663 19:29814740-29814762 GAAGCAGTTACACAAGAGTTTGG - Intronic
1167958739 19:53089321-53089343 GAAGAAGTTCCTCCACATTTTGG + Intronic
1168686960 19:58354637-58354659 GCAGCAGGTGCTCAGCAATATGG - Exonic
927213540 2:20653011-20653033 GAAGGAGTTGGTCAAGACTTGGG + Intergenic
927626519 2:24726609-24726631 GAAGCAATTGATAACCAATTTGG + Exonic
930642193 2:53864940-53864962 GAGCCAGTTGCTAAAAAATTGGG - Exonic
935324802 2:101926255-101926277 ACAGCTGTTGCTCAAAAATTAGG - Intergenic
936225966 2:110652000-110652022 CATGCAGTTGCTTAACAACTGGG - Intronic
936824488 2:116564479-116564501 AAAGCAGTTTCTCAGAAATTAGG + Intergenic
938753927 2:134362547-134362569 GATTCAGTTGCTCAGCATTTGGG + Intronic
940970608 2:159892698-159892720 GACACAGTTTCTCACCAATTAGG - Intronic
942387420 2:175457120-175457142 GGCGCAGTGGCTCAACACTTTGG + Intergenic
946243212 2:218369352-218369374 GAAGCAGCTGCTCAACGTTTTGG + Intergenic
1177176849 21:17708762-17708784 GTGGCAGTTGCACAGCAATTTGG - Intergenic
1180579980 22:16825101-16825123 GAAGCAGCTGCTTAGCATTTGGG - Intergenic
1182928710 22:34152583-34152605 GGAGCAGGTGATCAACAATGTGG - Intergenic
949495092 3:4623751-4623773 GAATCAGTTGCTAAGCAACTGGG + Intronic
951484804 3:23200057-23200079 GTAGCAGTTCCTGAACAAATGGG + Intergenic
952329730 3:32353306-32353328 CAAGCTTTTGCTGAACAATTTGG + Intronic
952653261 3:35751928-35751950 GAAACAGTATCTCAATAATTTGG + Intronic
953519969 3:43632449-43632471 GAAGCAGTTACTCCACTATATGG - Intronic
954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG + Exonic
956408743 3:68956284-68956306 GCATCAGTTGCTCAGCAATCTGG - Intergenic
956588628 3:70889616-70889638 GAAGCACTGGCTGAACAATATGG + Intergenic
956687451 3:71843391-71843413 AAAACAGTTGCTCAGAAATTTGG - Intergenic
957014197 3:75044033-75044055 TCTGCAGTGGCTCAACAATTTGG - Intergenic
957315280 3:78568728-78568750 GGAGCAGTTGGTAAACATTTTGG - Intergenic
959812955 3:110640685-110640707 GCATCAATTGCTCTACAATTTGG - Intergenic
961199369 3:125032246-125032268 GAAGCAGTGGCTCACTTATTTGG + Intronic
962376139 3:134860321-134860343 GAAGCAGTTGGTCTACACTTAGG - Intronic
965102685 3:164321291-164321313 GCAGCAGTTCCTCAACTTTTTGG - Intergenic
968015168 3:195324097-195324119 AAAGGATTTGATCAACAATTAGG + Intronic
969518804 4:7663947-7663969 GAAGCAGTTGCTTAAAATTTGGG + Intronic
971870570 4:32232184-32232206 GAAGCAGGTGCACAATATTTAGG - Intergenic
975627498 4:76364228-76364250 GCAGGATTTGATCAACAATTGGG - Intronic
976933623 4:90600421-90600443 GAAAAAGATGCTCAACAATAGGG - Intronic
977549055 4:98421254-98421276 GCAGAAGCTGCTGAACAATTGGG + Exonic
977824757 4:101517723-101517745 GAATCAGTTGTTTATCAATTTGG + Intronic
981407981 4:144393594-144393616 GATGCAGTTTCTTTACAATTTGG - Intergenic
981888225 4:149704411-149704433 GAAGCAATTGGTAAACAAGTTGG - Intergenic
982214618 4:153069982-153070004 GAAGCAATTGGTCAATTATTTGG - Intergenic
984151296 4:176135153-176135175 GAAGCTGTTGCTAAAAGATTAGG - Exonic
984616031 4:181898927-181898949 GAAGCAGTTGCTAAATTATAAGG + Intergenic
985667017 5:1186608-1186630 GAAGCTGCTGCTCAATAACTTGG + Intergenic
988149197 5:27354007-27354029 GAAGAAGTTGATCTCCAATTTGG + Intergenic
989149866 5:38288793-38288815 GAAGCAGTTGCTCAACAATTTGG - Intronic
989420147 5:41228530-41228552 AAAGCTTTTTCTCAACAATTAGG - Intronic
993823598 5:92652664-92652686 AAAGGAGTTGCTGAACAACTTGG - Intergenic
997568243 5:134905527-134905549 AAAGTAGTTGCAGAACAATTCGG + Intronic
1000274305 5:159719499-159719521 GTAAGAGTTGCCCAACAATTAGG - Intergenic
1006269926 6:32956466-32956488 GAAGGAGATGCTCAAGAAGTGGG - Intronic
1008303151 6:49867854-49867876 GAGAAAGTTGCTCAATAATTTGG - Intronic
1009206467 6:60807867-60807889 GAAAAAGTTGCTCCACAATACGG - Intergenic
1009350109 6:62663920-62663942 GGAGCAGTTACTTAACAAATAGG - Intergenic
1009900264 6:69800729-69800751 GATGGAGTTGCTCAGCCATTTGG - Intergenic
1012130118 6:95480447-95480469 GAAGCAGTTCCTGGACAACTGGG - Intergenic
1013826488 6:114217024-114217046 GCTCCAGCTGCTCAACAATTTGG + Intronic
1017001018 6:149997533-149997555 AGAGCATTTGCTCAAGAATTAGG + Intergenic
1031473392 7:122193435-122193457 GAAGAAGTTGCTTAAAATTTGGG - Intergenic
1033490974 7:141843298-141843320 AAAGCAGTGGATCAATAATTTGG - Intergenic
1036544440 8:9753290-9753312 GAAGCAGTTGCCCATTAATTTGG + Intronic
1036947361 8:13106609-13106631 GGCACAGTGGCTCAACAATTTGG - Intronic
1037377089 8:18242474-18242496 GAAACAGTTGCTCATAATTTGGG - Intergenic
1039627089 8:39065227-39065249 GAAGAAGTTGCTCAGAAAGTAGG - Intronic
1042573440 8:70192250-70192272 GAAGCAAATGCTCAACTCTTTGG - Intronic
1043590417 8:81826058-81826080 GAAGGAGTTGTCCCACAATTGGG + Intronic
1043686315 8:83090934-83090956 GAAGGACATTCTCAACAATTAGG + Intergenic
1044422874 8:92018708-92018730 AAAGCAATTGCTTAACACTTGGG + Intronic
1044846153 8:96383864-96383886 GAATTAGTTGCTCAAGATTTAGG - Intergenic
1045838857 8:106556148-106556170 TAAGCAGTTGCTCCTCATTTTGG - Intronic
1050586493 9:7117478-7117500 AAAGCATTTACTCAACAATAAGG - Intergenic
1060554495 9:124501299-124501321 GAAGCAGGAGCTCAACAGTCAGG - Intronic
1186701963 X:12100142-12100164 GCAGCTGTAGCTCAACTATTTGG + Intergenic
1189126997 X:38459340-38459362 AGAGAAGTTGCTCAACCATTGGG - Intronic
1189241593 X:39528836-39528858 GAAACAGTGGCTAATCAATTGGG + Intergenic
1197086814 X:122487192-122487214 GAAAAAGTTGCTTAACTATTAGG - Intergenic