ID: 989153033

View in Genome Browser
Species Human (GRCh38)
Location 5:38319026-38319048
Sequence CATGCTCCAGGCTCATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989153028_989153033 8 Left 989153028 5:38318995-38319017 CCATAGTCCTCACTAGGCGTTCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 989153033 5:38319026-38319048 CATGCTCCAGGCTCATGAGATGG 0: 1
1: 1
2: 0
3: 10
4: 161
989153029_989153033 1 Left 989153029 5:38319002-38319024 CCTCACTAGGCGTTCCTATGTGG 0: 1
1: 0
2: 1
3: 1
4: 33
Right 989153033 5:38319026-38319048 CATGCTCCAGGCTCATGAGATGG 0: 1
1: 1
2: 0
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989153033 Original CRISPR CATGCTCCAGGCTCATGAGA TGG Intronic
900988626 1:6087340-6087362 CATGCCCCAGGCTCCTGGGTGGG + Intronic
901736650 1:11316749-11316771 CATCCTCCAGGGGCAAGAGAAGG - Intergenic
904013005 1:27400575-27400597 CTTGCTCCCAGCTCCTGAGAAGG - Intergenic
904799063 1:33080273-33080295 CAGGCACCAGGCTCTTGAGCAGG + Intronic
904990730 1:34590576-34590598 CCTTCTCCAGGCTAAGGAGAAGG + Intergenic
906087681 1:43149681-43149703 CATGCTCAAGGGACATGAGCTGG - Intronic
907457687 1:54585941-54585963 CAGGCCCCAGGCTGATGGGAGGG - Intronic
910225216 1:84929521-84929543 TATTCTCCATGCTCCTGAGATGG - Intronic
912636037 1:111294187-111294209 CATGCCCCATGTTCATGAGTTGG - Intronic
915926317 1:160022593-160022615 CAGGCTCCAGGGTCATTAAAAGG + Intergenic
917949830 1:180020054-180020076 CATGCTCTAAACTCAAGAGATGG - Exonic
918244074 1:182643693-182643715 CATGCTCAAGTTTAATGAGAAGG + Intergenic
918290257 1:183100524-183100546 CATCATCCAGGCACATGAAATGG - Intronic
919732585 1:200922695-200922717 CATGTTGCAGGCTCTTGTGATGG + Intergenic
920703186 1:208233202-208233224 CATTGTCCAGGCTCTTGAGGAGG - Intronic
922110006 1:222547470-222547492 CAGGCTCCAGGAGAATGAGAGGG - Intronic
922593847 1:226798817-226798839 CAGGCGCCAGGCTCAGGAAACGG - Intergenic
1063152050 10:3345839-3345861 CATTATCCTGGCTAATGAGAGGG - Intergenic
1068498747 10:57817601-57817623 CACCCTTCAGGCTCATAAGAGGG + Intergenic
1068577410 10:58699804-58699826 CCTGCTCCAGCCTCCTGAGATGG + Intronic
1072478040 10:95782508-95782530 CATGCTCCTGGCTAATCAGAAGG + Intronic
1074013632 10:109509834-109509856 CATGCATCAGGCTCAGGAGATGG - Intergenic
1075028145 10:119002176-119002198 CATGCCCCAGGCTCCTGGTAGGG - Intergenic
1075533030 10:123246301-123246323 TATTTGCCAGGCTCATGAGAAGG + Intergenic
1076441377 10:130483537-130483559 CTTGCTCCAGCCTCATGGGATGG + Intergenic
1076717019 10:132371304-132371326 CAAGCTCCTGGCTCATGGGCTGG - Intronic
1078151578 11:8764106-8764128 CATGCCCCAGCCTCCTGAGTAGG - Intronic
1078884135 11:15482866-15482888 CATTCTCCACTCTGATGAGATGG - Intergenic
1079130851 11:17746171-17746193 GCTGCTCCAGGCTCAGGGGATGG - Intronic
1079159209 11:17976828-17976850 CATGCTGCAAGCTCACCAGATGG - Intronic
1086247037 11:84765474-84765496 CATGATCCAGGATTTTGAGAAGG - Intronic
1090350277 11:126103685-126103707 CATGCCCCAGGCTCACTCGAAGG + Intergenic
1091240013 11:134046071-134046093 CCTGCCCCAGGCTCCTGAGCAGG + Intergenic
1091240025 11:134046116-134046138 CCTGCCCCAGGCTCCTGAGCAGG + Intergenic
1091240037 11:134046161-134046183 CCTGCCCCAGGCTCCTGAGCAGG + Intergenic
1092057962 12:5522906-5522928 CGTGGCCCAGGCCCATGAGATGG - Intergenic
1096410985 12:51377085-51377107 CAGGCAACAGGCTCATGAGGTGG + Intronic
1096789523 12:54036169-54036191 CCTTCTCCAGGCTCCTGGGATGG + Intronic
1098079392 12:66767983-66768005 TATGCTGCAGGCTTATGAAAGGG + Intronic
1098764889 12:74474054-74474076 GAAGCTCCAGTTTCATGAGATGG + Intergenic
1103593812 12:122010849-122010871 AATGCTGCAGGCTCAAGACAAGG + Intergenic
1104406927 12:128525701-128525723 CGTGCCCCAGGTTCCTGAGAGGG + Intronic
1106199369 13:27523688-27523710 CACGCTCCAGCCTCATGGGAAGG - Intergenic
1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG + Intergenic
1113184935 13:107677156-107677178 CATGCTTCAGCCTCCTGAGTAGG + Intronic
1117273996 14:54174052-54174074 CAGGCTCCAGACTCAGAAGAAGG + Intergenic
1122155860 14:99750091-99750113 CTGGCTCCAGGCTCAGGTGACGG - Intronic
1122283124 14:100635966-100635988 CCTGCTCCAGGCTCAGGGGGTGG + Intergenic
1126736817 15:51738393-51738415 CATTCTCCAGGCTCAGTAGTTGG + Intronic
1127633831 15:60850566-60850588 CATGCACCAGGCACAGGAGAGGG - Intronic
1128419270 15:67476098-67476120 CCTGCTTCAGGATCATGAGGTGG - Intronic
1131906578 15:97149291-97149313 CATTCTCCAGGGGCCTGAGAGGG + Intergenic
1134100442 16:11448080-11448102 CAAGATCCAGGCTGAAGAGAGGG + Intronic
1134661590 16:15988484-15988506 CATGTTCCAGGGTCTTGTGAGGG - Intronic
1136015956 16:27401431-27401453 CATGCCAGAGGCCCATGAGAGGG - Intergenic
1138913537 16:61432915-61432937 CATGGGCCAGTCTCAAGAGAAGG - Intergenic
1139097746 16:63726010-63726032 AATGCTCCTGGCTCATCAAAGGG + Intergenic
1140886078 16:79244587-79244609 AATATTCCAGGCTCATGAGTAGG + Intergenic
1141089667 16:81121555-81121577 CATGCTCATAGCTCATGAGCAGG - Intergenic
1141091459 16:81133220-81133242 CAGACTCCAGGCCGATGAGATGG + Intergenic
1142283575 16:89161596-89161618 CAGGCTGCAGGCTCAGCAGAGGG + Intergenic
1143047389 17:4092902-4092924 CATGCTCCAGGGTCAGCAGTTGG - Intronic
1143651051 17:8264532-8264554 CGTGCACCAGGCTCTGGAGAGGG + Exonic
1144063319 17:11602447-11602469 CCAGCTCCAGGCTTAGGAGAAGG - Intronic
1146376885 17:32300689-32300711 CATGCTCCAGGCATATGATGAGG + Intronic
1148885676 17:50770907-50770929 CATGCTTCAGCCTCCTGAGTAGG + Intergenic
1150281545 17:63932051-63932073 CAGGCCCCAGGGCCATGAGAGGG + Intronic
1151882791 17:76905063-76905085 CAGGCCCCAGCCTCATGGGAGGG + Intronic
1152830731 17:82495740-82495762 CAGGGTCCAGGCTCCTGGGAAGG - Intergenic
1153339789 18:3961751-3961773 CATGCTCCAGGTACCTGGGATGG - Intronic
1159939041 18:74392027-74392049 CATGATCCAGGCTCTTGGGCTGG + Intergenic
1160326563 18:77955060-77955082 CTTGCCCCAGGGTCTTGAGAGGG + Intergenic
1160581998 18:79888286-79888308 CAGGCTGCAGACTCCTGAGAAGG + Intronic
1161114234 19:2488063-2488085 CATGCTCCAGGCTCTGGGGTGGG - Intergenic
1163125571 19:15242650-15242672 CGTGCTCCTGACTCAAGAGAGGG + Intronic
1163673659 19:18644538-18644560 CATGTTCCAGGCACACAAGAGGG - Intronic
1164692390 19:30221276-30221298 CAGGCTCCAGCCCCTTGAGATGG - Intergenic
1164981296 19:32616439-32616461 CCTGCTTCAGCCTCCTGAGAAGG - Intronic
1166473979 19:43104748-43104770 CATCCCCCAGCCTCATGTGATGG + Intronic
1166487939 19:43229821-43229843 CATCCCCCAGCCTCATGTGATGG + Intronic
1166494758 19:43291686-43291708 CATCCCCCAGCCTCATGTGATGG + Intergenic
1167723344 19:51194091-51194113 CAAGTTCCAGCCTGATGAGAGGG + Intergenic
1167760679 19:51446205-51446227 CAAGTTCCAGCCTGATGAGAGGG - Intergenic
1168307286 19:55442488-55442510 CCTGCGCCAGGCGCATGTGACGG + Exonic
929429098 2:41871565-41871587 CAGACTCCAGGCTCATGCCAAGG + Intergenic
931207244 2:60159822-60159844 CTGGCTCCAGGATGATGAGAAGG + Intergenic
936743885 2:115549842-115549864 CATGCTCCAGGAACATTTGATGG + Intronic
938453036 2:131440793-131440815 CATGGTCCACGTTCAGGAGAGGG + Intergenic
939752652 2:146066335-146066357 CATGCTTCAGGCTTCTGTGAAGG + Intergenic
1169265858 20:4167060-4167082 CCAGCTCCAAGCTCATGAAAGGG - Intronic
1172904447 20:38358436-38358458 CAGGCTCCAGGCTTTTGGGATGG + Intronic
1173061818 20:39669706-39669728 CAAGTTCCAGGCCCAGGAGATGG + Intergenic
1174458729 20:50668009-50668031 CCTGCCCCAGTCTCATGAGAGGG - Intronic
1174962443 20:55173822-55173844 CATGCCCCAGGCTCCCTAGATGG - Intergenic
1180025653 21:45160159-45160181 CATGCTCCAGGTCCCTTAGATGG + Intronic
1183429101 22:37755091-37755113 CTTGCTCCAGGCAGATGAGCTGG + Exonic
1184161077 22:42697712-42697734 CATGCTCCTGGCCCCCGAGACGG + Intronic
949186654 3:1200143-1200165 CCTGCTTCAGTCTCATGAGTAGG + Intronic
952470453 3:33644704-33644726 CATGCTCCATGCCCTTGATATGG - Intronic
952901991 3:38116826-38116848 CATCCTGCAGGCACATGAGGGGG + Exonic
952972960 3:38666263-38666285 GATGCTCCATGCTCATGGAATGG + Intergenic
954095641 3:48325702-48325724 CCTGCTTCAGCCTCCTGAGATGG + Intronic
954205809 3:49058008-49058030 CATACTCAAGGCTTCTGAGAAGG + Intronic
954812021 3:53254627-53254649 AGTGCTCCGGGCTCATGACAGGG - Intronic
961642932 3:128376156-128376178 CATGCCCCAGGCTCCTGTGCTGG - Intronic
963121479 3:141780556-141780578 CATTCATCAGGCTCATGACAAGG - Exonic
965789565 3:172373061-172373083 CCTGCTCTAGGCTGCTGAGAAGG - Intronic
967793161 3:193570792-193570814 CAAGCTTCAGGCTCATCATATGG + Intronic
968786201 4:2623922-2623944 CCTTCCCCAGGCTCATGACAGGG - Intronic
969056993 4:4408282-4408304 CATCCTCCAGGCTGCTGGGAGGG + Intronic
970207123 4:13666182-13666204 CAGGCTCATGACTCATGAGAGGG - Intergenic
971645840 4:29201481-29201503 CATGGTCTATGCTCATGAGTGGG + Intergenic
976677521 4:87719679-87719701 CATCCTCCAGTCTCCTGTGAGGG - Intergenic
978205785 4:106079678-106079700 AATGTTCCATGCTCATGAAAAGG + Intronic
983296702 4:165875271-165875293 CTTCCTCCAGGCCCAAGAGAGGG - Intronic
984725285 4:183014105-183014127 CATGCCCCAGGCACCTTAGAGGG - Intergenic
989153033 5:38319026-38319048 CATGCTCCAGGCTCATGAGATGG + Intronic
989153296 5:38320856-38320878 CATGCTCCAGGCCCATGAGATGG - Intronic
992994213 5:82316596-82316618 CAGGCACCAGTCTCAAGAGAAGG + Intronic
998098998 5:139416466-139416488 CATGATCCAGCCCCATGAGATGG + Intronic
998377494 5:141700947-141700969 CAGGCACCAGGCCCATGTGAGGG - Intergenic
998949918 5:147383060-147383082 CATCCTCCAGCCCCATGGGAGGG - Intronic
998964469 5:147524250-147524272 CCTGCTCCAGCCTCCTGAGTAGG - Intergenic
999657580 5:153825797-153825819 CATTCTCCAGGGTCATGTTAAGG + Intergenic
1000607910 5:163344152-163344174 CATCCTCCAGGCCCCAGAGATGG + Intergenic
1002710733 5:181193359-181193381 CATCCTCCAGGCTGAGGACAGGG - Intergenic
1006894965 6:37462308-37462330 TATGCTCCATGCTTATGTGAGGG + Intronic
1007026879 6:38585124-38585146 CATGCTCTTGTCTCCTGAGATGG - Intronic
1007701333 6:43768241-43768263 CATGCTCTAGGCTGATGAACGGG - Intergenic
1011438339 6:87362046-87362068 CCTGCTTCAAGCTCATGAGTGGG - Intronic
1011523209 6:88233648-88233670 GATGCTCCATGTTCATGAGTTGG + Intergenic
1015669224 6:135668556-135668578 AATGGTCCAAGCTAATGAGAAGG + Intergenic
1018555686 6:165048646-165048668 TATGATCCATACTCATGAGAGGG + Intergenic
1020076761 7:5263495-5263517 CATCCTCCGGGCTCTTGGGAAGG + Intergenic
1020819950 7:12954870-12954892 CATGCTCCAGGCTTCTGTGAAGG + Intergenic
1023334825 7:39157994-39158016 CATGCTACAGGCTGAAGAGCAGG + Intronic
1024110832 7:46144981-46145003 CAGGATCCCTGCTCATGAGAAGG + Intergenic
1024198953 7:47087627-47087649 CCTGCTCCAGGCCAAAGAGAGGG + Intergenic
1027787327 7:82597187-82597209 CATGCACCTGGCTCAAGACATGG - Intergenic
1029284637 7:99457256-99457278 CATTTTCCAGGCTCAGGACAGGG - Exonic
1031997703 7:128243460-128243482 CAGGAGCCAGGCTCATGAAAGGG + Intronic
1032089907 7:128906299-128906321 CATGCTCCTGGCTCAGGGCAGGG + Exonic
1032092337 7:128917235-128917257 CATGCTCCTGGCTCAGGGCAGGG - Intergenic
1032806926 7:135364263-135364285 CTTGCTCAAGGATCAGGAGAGGG + Intronic
1034072181 7:148196893-148196915 CAGGGTCCAGGCTCAAGGGAGGG + Intronic
1034266692 7:149784540-149784562 CATCCTCCAGGCTCTGGAGCAGG - Intergenic
1035026808 7:155831584-155831606 CAGGCTCCAGGCTGAGGAGTGGG - Intergenic
1035677136 8:1463754-1463776 CGTGCTCCAGGCCCATCTGACGG - Intergenic
1036209350 8:6829625-6829647 CATGCTTCAGTCTCCTGAGTAGG + Intronic
1037283973 8:17276002-17276024 CATGCCTCAGTCACATGAGACGG - Intronic
1037743596 8:21626402-21626424 CTTTCTCCAGGCTAATGGGAAGG + Intergenic
1039350606 8:36759721-36759743 CATGCGACTGACTCATGAGAAGG - Intergenic
1042811522 8:72830672-72830694 CATGCTTCTGGCTCATCAGCAGG + Intronic
1044502256 8:92971667-92971689 CATTCTCCATGCTCATGAATAGG + Intronic
1044934989 8:97285422-97285444 CAGGCTCCAGGCTCTTGTCAGGG - Intergenic
1047440369 8:124872282-124872304 CACTCTGCAGGATCATGAGAGGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1050277928 9:4019263-4019285 CATCCTCGAGGATCATTAGAAGG + Intronic
1051750580 9:20337288-20337310 CATGCAACAGGCTCAGGAAATGG + Intergenic
1052219951 9:26008151-26008173 CTGCCTCCAGTCTCATGAGATGG + Intergenic
1052781057 9:32782841-32782863 CCAGCTCCAGGCTCGGGAGAGGG - Intergenic
1052809787 9:33047379-33047401 CATGTTCCAGGTGCACGAGAAGG - Exonic
1056728474 9:89142992-89143014 CCTGATCCAGACTCAAGAGAGGG + Intronic
1057610358 9:96537376-96537398 TATGCCCCAGGCTCCTGGGATGG + Intronic
1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG + Intergenic
1059354700 9:113689460-113689482 CTGCCTCCAGGCTCATGACAAGG + Intergenic
1189219638 X:39360316-39360338 CATGCTGCAGCCTCAAGATATGG - Intergenic
1189975626 X:46459200-46459222 CCTGCTTCAGCCTCATGAGTAGG - Intronic
1191129327 X:56991540-56991562 CATGCTCCTGACTCAAGAAAAGG - Intronic
1194946568 X:100075273-100075295 CAGGTTCCAGGGTCATGGGATGG - Intergenic
1198091407 X:133334425-133334447 CAAGCTTCAGGCTCATGGGAGGG + Intronic
1198191321 X:134309686-134309708 CATCCCCCAGCCTCATGTGATGG - Intergenic
1200272176 X:154696422-154696444 CATGCTTCTGACTCAGGAGAAGG - Intronic