ID: 989153354

View in Genome Browser
Species Human (GRCh38)
Location 5:38321345-38321367
Sequence CTGTAAATACAGACGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 10, 2: 18, 3: 22, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989153354 Original CRISPR CTGTAAATACAGACGAAGCT TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
901104977 1:6748163-6748185 CTGTTTATATAGACAAAGCTTGG - Intergenic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
908604390 1:65779008-65779030 CTGTAAATAGAGACAAAGAAGGG + Intergenic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
919628330 1:199934573-199934595 CAGTAAATAGAGACGGAGATGGG + Intergenic
919997352 1:202765157-202765179 CTGTAAATACTGACAGACCTTGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920512352 1:206560459-206560481 CTGAAAAGAGAGACCAAGCTAGG - Intronic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1078566304 11:12417690-12417712 CTGTAAATACAAACTTAACTTGG - Intronic
1083061449 11:59877028-59877050 CTGGAAATATGGACGGAGCTTGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085009637 11:73129371-73129393 CTGTAAGTATGGACGAAGCTTGG - Intronic
1085536360 11:77222309-77222331 CTGTAAAGACCGTCAAAGCTAGG - Intronic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1091806825 12:3362828-3362850 CTGTAAATACAGGCCAAGGCTGG + Intergenic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099746731 12:86714346-86714368 CAGTAAATACATACAAAGCAGGG + Intronic
1102866768 12:116381142-116381164 CTGTAAATCAAGACGAAGAGCGG + Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1116805182 14:49487520-49487542 CTCTAATTACAGAAGAGGCTAGG - Intergenic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118386981 14:65264145-65264167 CTAAAAATACAGACATAGCTGGG + Intergenic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1130902059 15:88214774-88214796 TGGTAAATTCAGACAAAGCTGGG - Intronic
1131953981 15:97711463-97711485 CTATAAATACAGACAAGGTTTGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1136174981 16:28510434-28510456 CTAAAAATACAGACCAAGCTCGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1142956864 17:3528547-3528569 CTGTAAATATAGAACTAGCTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1151416741 17:73971243-73971265 CTGTAAATACCCATGAATCTGGG - Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1168037179 19:53729266-53729288 CTGAAAATACAAACTTAGCTAGG - Intergenic
1168223019 19:54974744-54974766 CTATAAATACATACAAAGCGGGG + Intronic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
930214742 2:48683083-48683105 ATGTAAATACACACTAAGCCAGG + Intronic
930654776 2:53997070-53997092 CTGTAAATACAAACGAATATTGG - Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
1169629525 20:7613390-7613412 CTTTAAATACAGACTCAGGTAGG + Intergenic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179656315 21:42847299-42847321 CTCTAAATACACGCGGAGCTGGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183257242 22:36770483-36770505 TTGGATATACAGACAAAGCTTGG - Intronic
1183855965 22:40635448-40635470 ATGTAAAAACATACGAAGCATGG + Intronic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
955487315 3:59448020-59448042 GTCTAAATACAGACGAAAGTTGG - Intergenic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
958138276 3:89525764-89525786 CTGTAAATGCTGACTCAGCTGGG - Intergenic
958553736 3:95647100-95647122 CTGTAAAGACCGTCGATGCTAGG + Intergenic
959689359 3:109181964-109181986 CTGGAAATAGAGACGTAGTTTGG + Intergenic
965341252 3:167493886-167493908 GAGGAAATACAGACGAAGATGGG - Intronic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
968012656 3:195295272-195295294 CTGTAAATAGCGACGAGGCCAGG - Intronic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973938410 4:55876523-55876545 CTGAAAACTCAGACTAAGCTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979161875 4:117471865-117471887 CTTTAAATAGAGACTAAGTTGGG - Intergenic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985217035 4:187664563-187664585 CTGTAAAGACAGACGTACTTGGG - Intergenic
985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992274476 5:75101011-75101033 CTGTAAAGACCGTCGATGCTAGG - Intronic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
996494670 5:124140075-124140097 CAGGAAATACAGACAGAGCTTGG + Intergenic
998576056 5:143317944-143317966 CTTTACATACAGACAAATCTGGG + Intronic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1010141403 6:72619280-72619302 CTTTGAATACAGACGTTGCTAGG - Intergenic
1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG + Intronic
1010749693 6:79604155-79604177 CTGGAAATACAGACTTAGATTGG - Intergenic
1010898600 6:81398087-81398109 CTGTAAATACAGGCAAATCTTGG - Intergenic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1016725277 6:147358029-147358051 CTGTCATTACAGACAGAGCTGGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018253662 6:161896679-161896701 TTGTAAACACTTACGAAGCTTGG - Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024023084 7:45388452-45388474 AAGTAAATACAGACCAGGCTGGG - Intergenic
1024895199 7:54251974-54251996 CTGTAAGTACAGACAAATATTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1056688061 9:88783028-88783050 CTGTAAATCCAGTCGCAGCCTGG - Intergenic
1059054329 9:110962947-110962969 CTGTGAATACACACTAAGGTGGG - Intronic
1060514982 9:124259860-124259882 CTCTAAATCCAGACCAACCTGGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186885318 X:13907344-13907366 TTGTAAAGTCAGACGAACCTGGG - Intronic
1188091631 X:25971482-25971504 CTGTGATCACAGACGATGCTTGG - Intergenic
1192910610 X:75600586-75600608 TTGTAAAGACAGTCGAGGCTAGG - Intergenic
1198856035 X:141017851-141017873 CTGTAAAGACCATCGAAGCTAGG - Intergenic
1198876097 X:141228260-141228282 CTGTAAAGACCATCGAAGCTAGG + Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1198906656 X:141569516-141569538 CTGTAAAGACCATCGAAGCTAGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201590865 Y:15612923-15612945 TTGTAAATACCGTCGAGGCTAGG + Intergenic