ID: 989161222

View in Genome Browser
Species Human (GRCh38)
Location 5:38393659-38393681
Sequence GTCCTTGCGGGAGGAAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989161215_989161222 -9 Left 989161215 5:38393645-38393667 CCCACCGCTGGCCAGTCCTTGCG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 989161222 5:38393659-38393681 GTCCTTGCGGGAGGAAGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 151
989161211_989161222 30 Left 989161211 5:38393606-38393628 CCTTCGTGGGCTGGAACTGGAGT 0: 1
1: 11
2: 46
3: 58
4: 160
Right 989161222 5:38393659-38393681 GTCCTTGCGGGAGGAAGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 151
989161216_989161222 -10 Left 989161216 5:38393646-38393668 CCACCGCTGGCCAGTCCTTGCGG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 989161222 5:38393659-38393681 GTCCTTGCGGGAGGAAGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989161222 Original CRISPR GTCCTTGCGGGAGGAAGAGT TGG Intronic
900077322 1:827854-827876 GTGCTGGCGGGAGCGAGAGTCGG + Intergenic
901629001 1:10639184-10639206 GTCCTCGCAGGAGGACGAGGAGG - Exonic
902337277 1:15760802-15760824 CTCTCTGGGGGAGGAAGAGTGGG + Intronic
903351961 1:22722680-22722702 CTTCTTGAGGGAGGTAGAGTTGG + Intronic
904200610 1:28816892-28816914 GGCCAGGCGGGAGGAAGAGGGGG - Intronic
906244751 1:44265069-44265091 ATGCTTGCGGGAGGGAGTGTTGG - Intronic
910838107 1:91535741-91535763 GTCCAAGCAGGAGGAAGAGGAGG - Intergenic
912799679 1:112713028-112713050 GTCCCTGGTGGAGGAAAAGTTGG + Exonic
913075498 1:115337998-115338020 ACCCTCGCGGGAGGACGAGTCGG - Intronic
913692995 1:121297210-121297232 GTCCTTTTTGGAGGAAGAGTTGG + Intronic
914144562 1:144982870-144982892 GTCCTTTTTGGAGGAAGAGTTGG - Intronic
916071705 1:161173974-161173996 GGCCCTGCGTGATGAAGAGTGGG - Exonic
917198052 1:172487280-172487302 GTCCACGGGGGAGGAAGAGAAGG - Intergenic
918301446 1:183207735-183207757 CTCCTTGCGGGAGGAAGATATGG - Intronic
919878973 1:201889670-201889692 GTCCGGGAGGGAGGAAGAGGAGG - Intronic
920097041 1:203492967-203492989 GTCCTTGCTGAAGGCAGAGGTGG - Intergenic
920365946 1:205448495-205448517 GTCCTGGAGGGAGGCAGTGTGGG - Intronic
920480317 1:206315580-206315602 GTCCTTTTTGGAGGAAGAGTTGG + Intronic
922756127 1:228097832-228097854 GTCCTGGGGGAAGGAAGGGTTGG - Exonic
923340229 1:233000533-233000555 GTCCTGGTGGGAAGAAGTGTGGG + Exonic
923879156 1:238084514-238084536 GTCCTTGTGGAAGGAAAAATTGG + Intergenic
1062938266 10:1403710-1403732 GTCCTTGCTGCAGGCCGAGTGGG - Intronic
1066474613 10:35733300-35733322 GGGCTTGTGGGAGGAAGAATGGG - Intergenic
1067101085 10:43335187-43335209 GTCCTTGGGGGAGGGAGAAAAGG + Intergenic
1074058922 10:109947264-109947286 GCCCTTGCAGGAGGAAGAAAGGG - Intronic
1075717447 10:124565302-124565324 GTTCTTGCAGAAGGAAGAGCTGG + Intronic
1077776600 11:5278886-5278908 GTACTTGCAGGACGAAGGGTGGG - Intronic
1078625105 11:12948304-12948326 GTCCTTGCTTCAGGAAGAGAAGG - Intergenic
1080793402 11:35541038-35541060 GTCCCTGAGGGCAGAAGAGTGGG + Intergenic
1083477874 11:62925783-62925805 GTCCTGGCGGGAGGGAGTGGGGG - Intergenic
1084476917 11:69394453-69394475 GTCAGTGCGGGAGGATGAGCCGG - Intergenic
1086438481 11:86804921-86804943 ATTCTTGGGGGAGAAAGAGTAGG - Intronic
1091467957 12:702037-702059 GGCCTGGAGGGAGGAAGGGTCGG + Intergenic
1091664297 12:2407955-2407977 GCCTTTGCTGGGGGAAGAGTGGG - Intronic
1092244555 12:6856336-6856358 CTGCTTGCGGGAGGCTGAGTCGG - Exonic
1094368849 12:29713970-29713992 GTCCTTACATGAGGAAGAGCAGG - Intronic
1095085763 12:38056340-38056362 CTACTTGAGGGAGGAGGAGTGGG - Intergenic
1102031815 12:109744082-109744104 GTCCCTGCAGGAGGAAGATGGGG - Exonic
1102740312 12:115201085-115201107 GTTCTAGCGGTAGGAAGACTGGG + Intergenic
1103416076 12:120742060-120742082 GTCCTTCGGTGAGGGAGAGTCGG + Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1111008158 13:82276505-82276527 GTGCTTGAGGGAGTCAGAGTGGG - Intergenic
1111042758 13:82771149-82771171 GTCCTTGTGGGGGGAACAATTGG + Intergenic
1115099510 14:29681559-29681581 GTACATGAGGGAGGGAGAGTTGG - Intronic
1117398382 14:55334937-55334959 TTCCTTGTGGGAGGTATAGTGGG + Intronic
1118576797 14:67250189-67250211 TTCCTGGAGGAAGGAAGAGTGGG - Intronic
1119326625 14:73763544-73763566 CTCATTGGGGGAGGAACAGTGGG - Intronic
1119733187 14:76964177-76964199 TTCCCTACAGGAGGAAGAGTTGG + Intergenic
1121554110 14:94823366-94823388 GCCCTTGCGGGAGGGAGAGGTGG - Intergenic
1122299294 14:100722948-100722970 GTCCCTTGGGGAGGAAGAGCAGG + Intergenic
1129737931 15:77976159-77976181 GTCCTCGCAGAAGGCAGAGTAGG - Intergenic
1129848148 15:78777450-78777472 GTCCTCGCAGAAGGCAGAGTAGG + Exonic
1129937507 15:79463158-79463180 GGCCTTGAGGGAGGCAGGGTAGG - Exonic
1130190271 15:81728061-81728083 CTCTTTGCGGAGGGAAGAGTTGG - Intergenic
1130253773 15:82316486-82316508 GTCCTCGCAGAAGGCAGAGTAGG - Intergenic
1131861554 15:96659196-96659218 GGCGATGCGGGAGGAAGACTTGG + Intergenic
1132362694 15:101230857-101230879 GTCCTTGAGGGAGAAAAAGGTGG + Intronic
1136751208 16:32637751-32637773 GTCCTGGCGGGGGGAAGCGTGGG + Intergenic
1138620504 16:58207280-58207302 GGCCTAAGGGGAGGAAGAGTAGG - Intergenic
1139356332 16:66368995-66369017 GGGCTTGCTGGAGGAAGAGTGGG + Intronic
1140608565 16:76570599-76570621 ATCATTGCGGGAGGAAAAGGAGG - Intronic
1142289977 16:89189483-89189505 GTCCTTGGGTGAGAGAGAGTGGG + Intronic
1203053342 16_KI270728v1_random:897006-897028 GTCCTGGCGGGGGGAAGCGTGGG + Intergenic
1142519414 17:494380-494402 GTCCTTCCGGGTGGGAGAGAAGG + Intergenic
1148210754 17:45807035-45807057 GTCCTGGAGGGAGGCAGAGACGG - Exonic
1148813607 17:50311000-50311022 GTCTTTGGGGGAGGGAGAGTTGG + Intergenic
1150301935 17:64054436-64054458 GCCCCTGCGGGATGAGGAGTGGG + Exonic
1150433430 17:65137149-65137171 GACCTAGCGGGAGGAGGAGGAGG - Intergenic
1150433437 17:65137171-65137193 GACCTGGCGGGAGGAGGAGGAGG - Intergenic
1150956640 17:69867146-69867168 GTCCTTGATGAAGGAAGAGTGGG + Intergenic
1150989588 17:70241151-70241173 TTCCTTGAGAAAGGAAGAGTGGG + Intergenic
1151039614 17:70843449-70843471 GACCTTGTGGGAGGAGGAGCTGG - Intergenic
1151423037 17:74011158-74011180 GTCCTTGTGGGAGGAGAAGGAGG - Intergenic
1151527500 17:74681057-74681079 CTCCTTGGGGAATGAAGAGTGGG - Intronic
1156460731 18:37319969-37319991 GCCCTGGCGGGGGGAAGGGTAGG + Intronic
1156469233 18:37367145-37367167 GTGTTTGCAGGAGGAAGAGGAGG + Intronic
1158498233 18:57975947-57975969 GTACTAGCAGGAGGAAGAGAAGG - Intergenic
1162395560 19:10416606-10416628 GCCCCCGCGGGAGGAAGGGTGGG + Intronic
1162564987 19:11441049-11441071 GTCCTTGAAAGAGGAACAGTGGG - Intronic
1162666920 19:12221175-12221197 GTCCTTGCAGGAGGATGATCAGG + Intergenic
1165910375 19:39222396-39222418 GGACATGTGGGAGGAAGAGTTGG + Intergenic
1166218974 19:41353419-41353441 GTCTTTGCGGGAGGCCGGGTCGG + Exonic
1166788302 19:45382622-45382644 GTCCTTCCGCGAGGGCGAGTCGG - Exonic
1167705374 19:51078454-51078476 ATCCTTGAGGGAGGCAGAGATGG - Intronic
1168326330 19:55540604-55540626 GTCCTTGAGGGAGGAAGGGATGG + Intergenic
929133622 2:38602597-38602619 CTCCCTGGGGGAGGAAGAGGAGG + Exonic
931460238 2:62443896-62443918 CTCCTTGAAGGAGGAAGATTGGG + Intergenic
931681403 2:64752017-64752039 ATCCGTGCGGGAGGGAGGGTTGG - Intergenic
931941306 2:67254781-67254803 GTCCTCGTGGGAGGCAGCGTGGG + Intergenic
937002598 2:118481857-118481879 GGCCTTGCGGGTGGAGGAGAGGG - Intergenic
937268345 2:120631401-120631423 GGGCTTGCGGGTGGAATAGTGGG + Intergenic
938465266 2:131520816-131520838 GGCCTTGAGGTAGGCAGAGTGGG + Intergenic
940425209 2:153524371-153524393 GTCCTTGCAGGGGGAATAATTGG - Intergenic
944407707 2:199403972-199403994 TTCCTGGCTGGAGAAAGAGTAGG + Intronic
948646877 2:239410935-239410957 GTCCTTGGTGGGGAAAGAGTGGG + Intergenic
948724968 2:239928958-239928980 GTAGGTGCAGGAGGAAGAGTCGG - Intronic
1171217999 20:23366009-23366031 CACCGTGCTGGAGGAAGAGTTGG + Intronic
1172319290 20:33983594-33983616 CTTCTTGAGGGAGGAAGAGGTGG + Intergenic
1174182382 20:48682999-48683021 GCCCTGGCTGGAGGCAGAGTGGG + Intronic
1174420510 20:50396357-50396379 GTCCTTGTGGGAGGGAAAGGAGG - Intergenic
1175923165 20:62459334-62459356 GTCCCTGAGGGAGGCTGAGTGGG - Intergenic
1176138065 20:63533698-63533720 GCTCGTGCTGGAGGAAGAGTCGG + Exonic
1176739816 21:10590975-10590997 GTACTGGCAGGAGGAAGAGCAGG - Intronic
1179132941 21:38655223-38655245 GGCCCTGTGGGAGGAAGAGGGGG - Intronic
1181348904 22:22241514-22241536 GTCCATGAGAGAGGAAGAGCAGG + Intergenic
1184416584 22:44355400-44355422 TCCCTTGGGGGAGGAAGAGGTGG - Intergenic
1184544107 22:45154113-45154135 GTTCTTAAGGGAGGAAGAGCAGG - Intergenic
1185051723 22:48557560-48557582 CTCCTTGCAGGAGGCTGAGTGGG + Intronic
1185270847 22:49928821-49928843 GTACCTGGGGGAGGAAGAGAGGG + Intergenic
953582678 3:44171596-44171618 GCCCATGTTGGAGGAAGAGTGGG - Intergenic
953927824 3:46991287-46991309 GTCCTCGCTGGAGGAAAGGTAGG + Exonic
954072193 3:48151078-48151100 GTCCTTGGGGGAGGATGGGGAGG + Intergenic
959497373 3:107067224-107067246 GTCCATGTGGGTGGAAGTGTTGG + Intergenic
960729259 3:120707310-120707332 CTCATTGAGGAAGGAAGAGTGGG - Intronic
962045291 3:131752375-131752397 GTCCTTTGGGTAGGGAGAGTAGG + Intronic
962245271 3:133785604-133785626 GCCCGTCCGGGAGGGAGAGTGGG + Intronic
968348553 3:198032598-198032620 GTCATGGCGGAAGGCAGAGTGGG + Intronic
970079429 4:12263964-12263986 GTCCCAGCAGGAGGAAGAGGGGG - Intergenic
972143340 4:35989257-35989279 GTCCTTGTAGGAAGAAGTGTGGG + Intronic
979878674 4:125927631-125927653 GTCCTTGCAGGGGGAATAATTGG - Intergenic
980772289 4:137391677-137391699 GTCCCTGTGGGAAGAATAGTAGG - Intergenic
981332416 4:143527182-143527204 ATCCTTGTGGGAAGAAGAGATGG + Intronic
982072783 4:151710011-151710033 GTCCTTGAGGGATGAGGAGAGGG - Intronic
983995175 4:174174222-174174244 TACCTTGCAGGAGGAAGATTGGG + Intergenic
984766198 4:183402361-183402383 GTCCCTGCGGGAAGAAGAGCAGG - Intergenic
986773266 5:10992591-10992613 GGGCGTGCGGGAGGAGGAGTAGG + Exonic
987903776 5:24050017-24050039 GCACTTGTGGGAGGGAGAGTGGG + Intronic
988699785 5:33662034-33662056 GTCCTTGCTGGAGAAAGAAGAGG + Exonic
989161222 5:38393659-38393681 GTCCTTGCGGGAGGAAGAGTTGG + Intronic
989181051 5:38577490-38577512 GTTCTTGTGGGAGGAAGACTAGG - Intronic
994634076 5:102321680-102321702 GTACTTGCAGGAGGAACAATTGG + Intergenic
995064404 5:107843849-107843871 GTCCATGGTGGAGGAAGTGTGGG + Intergenic
998256779 5:140594352-140594374 GTCCCTGCAGGAGGCAGAGCAGG - Intergenic
999719143 5:154385849-154385871 ATCCTTGCGGGAGGCAGCCTAGG - Intronic
1001555006 5:172631184-172631206 GTCCTTGCTGGTGGCTGAGTGGG + Intergenic
1001796382 5:174505632-174505654 CACCTTGGGGGAGGAAGAGTTGG - Intergenic
1007022174 6:38531910-38531932 GTCCTTGTGGGAGCAGGAGTGGG - Intronic
1013298596 6:108781754-108781776 CTCCTTGGGTGAGGAGGAGTGGG + Intergenic
1016031742 6:139344908-139344930 GTCTTTTCAGGGGGAAGAGTGGG - Intergenic
1019235938 6:170612495-170612517 GTGCTGGCGGGAGCGAGAGTGGG - Intergenic
1019358235 7:592057-592079 GCCCTGGTGGGAGGAAAAGTGGG - Intronic
1019634325 7:2067404-2067426 CTTCCTGGGGGAGGAAGAGTGGG - Intronic
1020484335 7:8703032-8703054 GACATTGCTGGAGGAAGAGAGGG + Intronic
1022407356 7:30103103-30103125 GTGCTGGAGGGAGGAAGAATGGG + Intronic
1022626562 7:32042832-32042854 GTCCTTCCAGGAGGAAGTCTAGG - Intronic
1026446053 7:70485861-70485883 CTCCTTCCTGGAGGAAGAGCTGG - Intronic
1029262772 7:99314607-99314629 GGGCTTGTGGGAAGAAGAGTGGG + Intergenic
1030936476 7:115590902-115590924 GGACTTGGGGGAGGAAGAGTGGG + Intergenic
1033130756 7:138743618-138743640 TTCCTTGGGAGAGGAAGAATGGG + Intronic
1034267746 7:149789431-149789453 GGCCTTGCGGGAGGGAGTGCTGG - Intergenic
1035327081 7:158072191-158072213 GTCCTTGGGTGAGGATGAGTGGG - Intronic
1035515851 8:232028-232050 GTGCTGGCGGGAGCGAGAGTCGG - Intergenic
1039351860 8:36772078-36772100 GTCCTTGATGGAGGTAGAGCAGG + Intergenic
1041380484 8:57249420-57249442 GTCATTGAGGTAGGAAGGGTAGG + Intergenic
1045115419 8:98974577-98974599 GGCCCTGCGGGAGGAGGAGAGGG + Intergenic
1046679195 8:117149920-117149942 GTCCTGGCGGGAGTGAGTGTGGG - Intronic
1048538770 8:135323318-135323340 GTACATGCGGGAGGAAGTGGTGG - Intergenic
1048665717 8:136658353-136658375 ATCCTTGTGGGAGGAAGAAAGGG + Intergenic
1050456971 9:5843903-5843925 GTCCTGGGGGGAGGAAGGATGGG + Intergenic
1051965910 9:22829632-22829654 GTCCTTGCAAGAGGAATAATTGG + Intergenic
1053222594 9:36324693-36324715 GGCCTTGCGGCAGGAAAAGGTGG + Intergenic
1057596044 9:96417379-96417401 GTCCTTGCGGCAGGTGCAGTGGG - Intronic
1057954436 9:99396391-99396413 GGCCATGCGGGAGGAAGAGCTGG + Intergenic
1058226676 9:102372328-102372350 GTCCTTGGGTGAGGAGGGGTTGG + Intergenic
1058901540 9:109446622-109446644 GTCCTTGCTGGAGAAAGAGGAGG + Intronic
1187995828 X:24925394-24925416 TTCCTTGAGGTATGAAGAGTTGG - Intronic
1188516440 X:30992323-30992345 GTCCTTGTGTTAGTAAGAGTAGG - Intergenic
1198694736 X:139324060-139324082 GTCCTTGCTGGGGGAACAATCGG - Intergenic
1199443071 X:147890148-147890170 GTCTTTGCGGGTGGGACAGTTGG + Intergenic
1199513716 X:148652391-148652413 TTCCTTGCTGTAGGAAGTGTTGG - Intronic
1199532712 X:148868269-148868291 GGCCTTGGGGGAAGAAGAGCTGG - Intronic