ID: 989162102

View in Genome Browser
Species Human (GRCh38)
Location 5:38401216-38401238
Sequence AATTTCCTAGAGCAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989162097_989162102 10 Left 989162097 5:38401183-38401205 CCTTTTCTCTGAGGAGTTCCCTT 0: 1
1: 0
2: 4
3: 44
4: 327
Right 989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 211
989162098_989162102 -8 Left 989162098 5:38401201-38401223 CCCTTCAAGAAACAGAATTTCCT 0: 1
1: 0
2: 3
3: 47
4: 440
Right 989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 211
989162099_989162102 -9 Left 989162099 5:38401202-38401224 CCTTCAAGAAACAGAATTTCCTA 0: 1
1: 0
2: 0
3: 19
4: 308
Right 989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989162102 Original CRISPR AATTTCCTAGAGCAGATGGA GGG Intronic
900671830 1:3859118-3859140 AATTCCCAAGAGCAGAGGGAGGG + Intronic
902309516 1:15570584-15570606 CATTTCCTAGTGCAAATGGAAGG - Exonic
905098074 1:35492735-35492757 AATTCCCTACAGCTGATGAAAGG + Intronic
907304018 1:53503889-53503911 AATTTCAGAGAGCAGAGAGAGGG - Intergenic
910030799 1:82720227-82720249 AGTTTCCAACAGCAGATGAATGG - Intergenic
912149048 1:106833824-106833846 AATGTCCCTGAGGAGATGGAAGG + Intergenic
912189754 1:107324059-107324081 CATTTCTTAAAGCACATGGAAGG + Intronic
912407274 1:109450989-109451011 GATGTCCTACAGCAGATGAATGG + Intergenic
913313365 1:117527315-117527337 TATTTACAAAAGCAGATGGAGGG + Exonic
913481766 1:119295622-119295644 CATTTCCCAGGGCAGATTGAAGG + Intergenic
914322891 1:146582441-146582463 AATTTAGAAGTGCAGATGGAAGG - Intergenic
914979815 1:152404214-152404236 AAGTCCCTACAGGAGATGGAGGG + Intergenic
916821486 1:168403153-168403175 TCTTTCCCAGAGCAGATGGATGG + Intergenic
917537666 1:175886128-175886150 AGTGTCAGAGAGCAGATGGAAGG - Intergenic
918244305 1:182645490-182645512 CATTTCCAAGAGCAGCTGCAGGG + Intergenic
919318998 1:196010081-196010103 AATATCCCAGAGAAGAAGGATGG - Intergenic
922366719 1:224872161-224872183 ACTTTGTCAGAGCAGATGGATGG + Intergenic
923974424 1:239245530-239245552 AATTTCCAAAAGAAGATAGATGG + Intergenic
924204446 1:241697400-241697422 AAGATCCTGGAGAAGATGGAAGG - Intronic
924773343 1:247096129-247096151 AAGTATCCAGAGCAGATGGATGG + Intergenic
1063481005 10:6376419-6376441 ATTTTTCTAGAGCAGAGGAAAGG - Intergenic
1063665750 10:8059163-8059185 AGTTTCCAAGACCAAATGGAAGG + Intronic
1064288738 10:14014430-14014452 AAATTCCTAGAGCAGGAGGGGGG + Intronic
1064562060 10:16603435-16603457 AAATTCCCGGAGCAGATGCAAGG + Intronic
1065014043 10:21445247-21445269 AGGTTTCTAGAGCCGATGGAAGG - Intergenic
1065829702 10:29603596-29603618 AATTTAATAGAGCAGCTGGCTGG + Intronic
1066232120 10:33445974-33445996 AATTTCCTTTAGAAAATGGAAGG + Intergenic
1069295673 10:66841587-66841609 TATTTCCCAGAGTAGAGGGATGG + Intronic
1069693121 10:70367450-70367472 AATGTCCTTCAGCAGATGAAAGG + Intronic
1071218193 10:83432187-83432209 AATTTCAGAGAGGGGATGGAAGG - Intergenic
1073228890 10:101949994-101950016 AATTTCCTCAACCAGATAGAGGG + Intronic
1073842152 10:107510052-107510074 AATTTCACAGAGCAGGTGTAAGG + Intergenic
1074299134 10:112217394-112217416 AATGTCCTCCAGCAGATGAATGG - Intergenic
1074917246 10:117969280-117969302 AATTTCTGGGAGCAGAAGGAAGG - Intergenic
1078624865 11:12945816-12945838 AATTGCTCAGAGCAGAGGGAAGG + Intergenic
1078675552 11:13409534-13409556 ATGTTGCTAGAGCAGAGGGATGG - Intronic
1079186281 11:18240300-18240322 GATTTCATGGAGCAGGTGGAAGG + Intronic
1081565041 11:44255225-44255247 AATGTTCAAGAGCAGATGAATGG + Intergenic
1084965112 11:72740613-72740635 AATTTCCTAGGCCATCTGGATGG + Intronic
1085729469 11:78983945-78983967 AATGTTCTAGAGAAAATGGATGG + Intronic
1087963728 11:104386111-104386133 AAATTGCTAGAGCAGACTGAGGG - Intergenic
1088047859 11:105474924-105474946 AATTTCCTAATGCAAATGAATGG + Intergenic
1088142092 11:106629807-106629829 TGTTTCCTAAAGCAGATGCAAGG + Intergenic
1089697559 11:120225519-120225541 AAATTCCTAGACCAGCAGGAGGG + Intronic
1090336998 11:125976228-125976250 AATTTTCTAGAGCTGAAGGTAGG + Intronic
1090752812 11:129762428-129762450 CACTCCCTAGAGCAGATGCAGGG + Intergenic
1091591083 12:1843297-1843319 AATGTCCTGGAGCTGATGGCTGG - Intronic
1092995120 12:13942297-13942319 AATTGCCTAGAACAGTTGCAGGG - Intronic
1095737364 12:45572352-45572374 AATTTACTGGAGCAAATGAATGG - Intergenic
1096036016 12:48471335-48471357 AATGTCCATCAGCAGATGGATGG - Intergenic
1096124410 12:49109248-49109270 AAATTCCTAGAGAACAGGGAGGG - Intronic
1097616517 12:61890564-61890586 CATTTCCTATACCAGAGGGAGGG + Intronic
1099584237 12:84495749-84495771 AATATCCTTTAGGAGATGGATGG - Intergenic
1100585639 12:95976973-95976995 ATTTTGCTAGTGCAGATGAATGG - Intronic
1101205275 12:102481097-102481119 CATTTCCTAGAACCTATGGAGGG + Intergenic
1101353965 12:103959379-103959401 GAATTACTAGAGCATATGGAAGG + Intronic
1105891955 13:24688406-24688428 AAGTTCCTCAAGCAGATGGTGGG + Exonic
1108331420 13:49388799-49388821 AATCTCCAAGAAAAGATGGATGG + Intronic
1108981161 13:56516564-56516586 AATTTCCTAGAGCATCTCTAGGG - Intergenic
1109999575 13:70177459-70177481 AATTTCAGAGAGGAGATTGATGG - Intergenic
1113130504 13:107031468-107031490 CATTTCCTAGAACAGATAGCAGG + Intergenic
1117716228 14:58584553-58584575 AATGTCCAACAGCAGATGAATGG + Intergenic
1118038295 14:61891926-61891948 AATTCCCTACAGCAAATGGCAGG + Intergenic
1119109396 14:71957486-71957508 AAGTTCAGAGAGGAGATGGAAGG + Intronic
1119266899 14:73268110-73268132 TAGTTCCTGGAGCAGAGGGAAGG - Intronic
1119419135 14:74496455-74496477 CATTTCTTAGAGCTGGTGGAAGG + Exonic
1120294969 14:82628421-82628443 AACTTCTTGGAGAAGATGGATGG - Intergenic
1122136627 14:99636646-99636668 AATCTCCAACACCAGATGGAGGG + Intergenic
1124574205 15:30893685-30893707 AATGTCCTTCAGCAGGTGGATGG - Intergenic
1126120428 15:45246694-45246716 GATTTCCTATTGCTGATGGAGGG - Intergenic
1126493612 15:49266197-49266219 AGCTTCCAAGAGCAGGTGGAGGG + Intronic
1126545966 15:49874481-49874503 ATTGTCCTTGAGGAGATGGAAGG + Intronic
1126575474 15:50192300-50192322 AACAGCCTAGAGGAGATGGAAGG + Intronic
1126981518 15:54249639-54249661 AATTTCTAATAGCATATGGAAGG - Intronic
1129482523 15:75839225-75839247 AAATTTCTAGAGCAGATGGCAGG - Intergenic
1129580133 15:76800018-76800040 AGGTTCCTAGATCTGATGGAAGG - Intronic
1130660635 15:85829178-85829200 ATTTGCCTACAGCACATGGATGG - Intergenic
1130980898 15:88811288-88811310 TTTTTCCTAAAGCAGATGGAGGG + Intronic
1131310242 15:91284065-91284087 ACCTTCCTGGAGCAGAAGGAGGG + Exonic
1132517650 16:373277-373299 CAGTTCCCAGAGCAGATGGGAGG + Intronic
1133199670 16:4195639-4195661 AATTTCCTAGAGAAGCTGATTGG - Exonic
1138212691 16:55176349-55176371 ATTTTCCCAGAGTAGCTGGAGGG - Intergenic
1139161150 16:64511213-64511235 AATTCTACAGAGCAGATGGAAGG + Intergenic
1140010669 16:71128409-71128431 AATTTAGAAGTGCAGATGGAAGG + Intronic
1143166257 17:4898693-4898715 AATTTCCTACTGGAGATGGGTGG + Exonic
1144746891 17:17621893-17621915 AATTACATCGAGCAGATGGATGG + Intergenic
1146013265 17:29212670-29212692 AATTTCCTGGTGCAGAAGGAGGG - Intergenic
1147317902 17:39629566-39629588 AGTTTCCTGGGGCAGCTGGAAGG + Intronic
1148294063 17:46484487-46484509 AATTTCCTATAGCTGAAGAAAGG - Intergenic
1148316246 17:46702190-46702212 AATTTCCTATAGCTGAAGAAAGG - Intronic
1148536392 17:48442587-48442609 ACTTACCTAGAGAAGTTGGAAGG - Intergenic
1151457885 17:74237393-74237415 AAGTTCATACAGCAGATGGCGGG + Exonic
1155535282 18:26810408-26810430 ATTTTCCAAAAGCAGAGGGAAGG + Intergenic
1157332758 18:46715351-46715373 AATTGCCAGGAGCAGGTGGAGGG + Intronic
1163811643 19:19436319-19436341 CACCTCCTAGAGAAGATGGAGGG + Intronic
1165695242 19:37895794-37895816 AACTGCCTAGAGCTGATGGTAGG + Intronic
1166914087 19:46182758-46182780 AATGTCCTTCAGCAGGTGGATGG - Intergenic
927198199 2:20562547-20562569 AATTTGCTAGAGCAGCTCAAAGG - Intronic
930231272 2:48846316-48846338 TATTTCATGGAGCAGGTGGAAGG + Intergenic
932145913 2:69316872-69316894 AATTTTCTAGACCAGATTAAAGG - Intergenic
938988429 2:136602892-136602914 AATTTCCTAGAGATGTTGAATGG - Intergenic
940253807 2:151708104-151708126 GATATCCTAGAGCAGGTGGAAGG - Intronic
941354209 2:164468695-164468717 CAGCTCCTAAAGCAGATGGAAGG - Intergenic
943212047 2:184979422-184979444 AATTAACTAGAGGATATGGATGG - Intergenic
943533440 2:189116341-189116363 AGTGCCCTAGAGCAGAAGGAAGG - Intronic
944040514 2:195349089-195349111 AATTCCATAGAGCAGTTTGAAGG - Intergenic
945054588 2:205857407-205857429 CCTTCCCTAGAGCAGATGGCAGG + Intergenic
945185878 2:207139128-207139150 TGTTTTCTAGAGAAGATGGATGG - Intronic
948513597 2:238489055-238489077 AATCTCCTTGTGCATATGGAGGG - Intergenic
1169255188 20:4091651-4091673 AATTCCCTAGAGAAGAGAGAAGG - Intergenic
1171415717 20:24979299-24979321 TATTTCACAGAGAAGATGGAAGG + Intronic
1173057466 20:39629460-39629482 ATTTTCTTAGAGCAGGAGGAAGG + Intergenic
1173372808 20:42453512-42453534 TATTTCTTAGAGCAGATAGTGGG - Intronic
1177231568 21:18327582-18327604 AATTTTCTAGAGCACATCAAGGG - Intronic
1177329330 21:19635830-19635852 AATTTCCTAGGGCAGAGTAATGG + Intergenic
1177894932 21:26846203-26846225 AATTCCCTAGAGCATAAGGAGGG + Intergenic
1180071093 21:45436211-45436233 GATTTCCTTGAGCTGATGGTGGG + Intronic
1184415702 22:44350699-44350721 AGTTTCCCAAAGCAGATGGCTGG - Intergenic
1185175076 22:49321776-49321798 CGTTTCCCACAGCAGATGGAAGG - Intergenic
1185197338 22:49480270-49480292 AATTTTCTAGAGGAGATTCAGGG + Intronic
950238012 3:11340645-11340667 ATTGTCCTAAAGCAGTTGGATGG + Exonic
950473333 3:13199770-13199792 ATTTGCCTGGAGCAGAGGGAAGG - Intergenic
954682261 3:52352074-52352096 AACTTCCAAGAGAAGCTGGAAGG + Exonic
954984620 3:54778630-54778652 AAATTCCTTGAGGAGAGGGATGG + Intronic
955499456 3:59569809-59569831 TATTTCCTAGGGCTGCTGGAAGG + Intergenic
956336927 3:68175125-68175147 GATTTCCTAGTGTAGATGTATGG + Intronic
956876092 3:73465009-73465031 AATTTAGCAGAGCAGATGGTTGG - Intronic
957287820 3:78239547-78239569 AATTTCCGGGAGAACATGGAAGG + Intergenic
957559539 3:81804164-81804186 AATTTCCAAGAGAAGATGTTTGG - Intergenic
961009069 3:123424056-123424078 ACCGTCCTAGAGCAGATGGCTGG + Intronic
963793608 3:149609234-149609256 AATTTCCTGGTGGAGTTGGATGG - Intronic
964680861 3:159337011-159337033 TATTTCATTGAGCAGATGCAAGG + Intronic
967752539 3:193130726-193130748 AATTTCCTCGGGCAGACAGAGGG - Intergenic
967759950 3:193212543-193212565 AATTTCCCACAACAGATGAATGG - Intergenic
970338045 4:15073306-15073328 AGCTTCCTAGAGGAGATGGCAGG - Intergenic
972801332 4:42478687-42478709 GTTTTCCTAGAACAGAGGGAAGG + Intronic
973325298 4:48854530-48854552 AATTTCCTAATGCAAATGGTGGG - Intronic
973695562 4:53487123-53487145 AACTTCCCAGAGCAGAGAGATGG + Intronic
973912808 4:55599865-55599887 AAATTCCTAGAGCATAGGAATGG + Intronic
975814861 4:78206855-78206877 AATTCCCAAGAGCAGAAAGAGGG - Intronic
976244291 4:82992121-82992143 CATTTCCTTTAGCAGATGTAGGG + Intronic
977590968 4:98826768-98826790 GATTTCCTAGGGCTGAGGGAGGG - Intergenic
977779748 4:100966914-100966936 AATTTCCAAAAGGAAATGGAAGG - Intergenic
977854753 4:101875995-101876017 CCTTTCCTAAAGCAGAGGGAAGG - Intronic
977924103 4:102680493-102680515 GCTTTCCTAGACAAGATGGAAGG - Intronic
981844598 4:149153393-149153415 AATCTCCTACAGCAGATGAAGGG - Intergenic
983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG + Intergenic
984074926 4:175164498-175164520 AATAACCTAAAGCAGAAGGAAGG - Intergenic
984502885 4:180578523-180578545 CATTTATTAGAGCAGATAGAAGG - Intergenic
984793505 4:183635926-183635948 GCTTTCCTTCAGCAGATGGACGG + Intergenic
986403417 5:7401401-7401423 ACTTTGCTAGAGAAGATTGAAGG + Intronic
986486729 5:8245469-8245491 AATTTCCTAGAGGGAATTGAGGG + Intergenic
988932071 5:36046361-36046383 AATTTCCAACATCAGATGAATGG + Intronic
989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG + Intronic
989293389 5:39794988-39795010 GCTTTCCTAGAGCAGATTCAGGG - Intergenic
990950640 5:61294898-61294920 AATGTCCTAGAACAAATGGATGG - Intergenic
990961734 5:61400707-61400729 TAATTCCCAGAGCAGATGAAAGG - Intronic
991734432 5:69618780-69618802 AATTTCCTAGTGGAGAGTGATGG + Intergenic
991780546 5:70127945-70127967 AATTTCCTAGTGGAGAGTGATGG - Intergenic
991810866 5:70473915-70473937 AATTTCCTAGTGGAGAGTGATGG + Intergenic
991859834 5:71003368-71003390 AATTTCCTAGTGGAGAGTGATGG - Intronic
991872994 5:71128264-71128286 AATTTCCTAGTGGAGAGTGATGG - Intergenic
995838531 5:116421795-116421817 AAATGGCTAGAGCAGAAGGAGGG + Intergenic
997419082 5:133751638-133751660 AAATTCCGGTAGCAGATGGAGGG + Intergenic
997907810 5:137837033-137837055 TATCTCCTAGAGGAGTTGGATGG + Intergenic
998385566 5:141755292-141755314 ACTCTCCTAGAGCAGAGGCAAGG - Intergenic
1000491109 5:161914802-161914824 AATGTACTAGAGCAGGTGGTAGG + Intergenic
1001298858 5:170519003-170519025 ACTTGCCTAGAGCAGAGGGTGGG - Intronic
1003109746 6:3243563-3243585 AATTCCCTATAGTAGTTGGAGGG - Intronic
1004891859 6:20108588-20108610 AATTCCCTATAGCCGATGGAGGG - Intronic
1005802706 6:29443498-29443520 AATTTCCTTCAGCAGGTGAATGG - Intronic
1005890765 6:30135992-30136014 AATTACCTAGGGTAGCTGGAAGG - Intergenic
1006544905 6:34772374-34772396 AATTTCTTAGAGGAAATGGATGG - Intronic
1010596465 6:77769593-77769615 ACCTTCCTCAAGCAGATGGAAGG - Intronic
1010625778 6:78135024-78135046 GATTTCCTCGGTCAGATGGAAGG + Intergenic
1011180744 6:84617521-84617543 AATAACCTAGAGCAAATGGTAGG + Intergenic
1013658363 6:112269015-112269037 CATGGCCAAGAGCAGATGGATGG + Intergenic
1014179623 6:118370836-118370858 ACTTTGCCAGAGCAGAGGGAAGG + Intergenic
1014358455 6:120443222-120443244 AATATTCTAAAGCAGATGGATGG + Intergenic
1014433266 6:121393981-121394003 AATTTCCTAGGGCAGAATTAAGG - Intergenic
1014640323 6:123900950-123900972 ATTTTCTTTGAGAAGATGGAAGG + Intronic
1015179309 6:130344936-130344958 ATTTTGGTAGAGGAGATGGAGGG - Intronic
1015297364 6:131611821-131611843 TTTTTCCTAAAGCAGATTGATGG - Intronic
1019993989 7:4711551-4711573 AAGCTCCTAGAGCAGTTGGATGG + Intronic
1021165477 7:17334613-17334635 AATCTAATAGAGCAGATGTATGG - Intronic
1021749673 7:23783390-23783412 AATTTGCTTTAGCAGATGCAAGG + Intronic
1021853536 7:24831875-24831897 AATTCTCTAGAGCAGCTGGATGG + Intronic
1022980421 7:35600570-35600592 GACTCCTTAGAGCAGATGGAAGG - Intergenic
1023267352 7:38421011-38421033 GATTTCCTAGATCAGAGGGCAGG + Intronic
1028076112 7:86517772-86517794 GATTTACTAGATCAGATTGAAGG + Intergenic
1029007754 7:97228472-97228494 ATTTTCCTAAAGAAGAAGGATGG + Intergenic
1030976557 7:116131244-116131266 TATTTCCATGAGCATATGGATGG - Intronic
1034552946 7:151832780-151832802 TATTACCTAGAGAAGAGGGAGGG - Intronic
1034570789 7:151954660-151954682 AAATTCCTACAGCATGTGGAAGG - Intergenic
1035461994 7:159046314-159046336 AATGTCCATGAGCAGATGAACGG + Intronic
1036008522 8:4694172-4694194 TATTTCAGAGAGCAGAAGGAAGG - Intronic
1038514648 8:28176430-28176452 ATTTTCCTGGAGCAGCTGGCTGG - Intronic
1042939749 8:74095780-74095802 GATTTCCAAGAGCATGTGGAAGG - Intergenic
1044002606 8:86902621-86902643 AACTTCCTCAAGCAGATGAAAGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044742193 8:95339523-95339545 GTTTTCCCAGAGCGGATGGAAGG - Intergenic
1044756700 8:95470106-95470128 AAATTCATGGACCAGATGGATGG + Intergenic
1045373756 8:101550997-101551019 AATGTCCAACAGCAGATGAATGG - Intronic
1045751338 8:105487632-105487654 TATTTACAAAAGCAGATGGAGGG + Intronic
1046979191 8:120318314-120318336 GTTTGCCTAGAGGAGATGGAAGG + Intronic
1048416015 8:134228774-134228796 ATTATGCTAGAGCAGAGGGAAGG + Intergenic
1048986133 8:139736052-139736074 AGTTTCATAGATGAGATGGAGGG - Intronic
1049904340 9:201927-201949 AAATTGAAAGAGCAGATGGATGG + Intergenic
1049946421 9:600993-601015 AATTAACTAAAGCAGAAGGAGGG + Intronic
1051841068 9:21398946-21398968 GTTCTCCTGGAGCAGATGGATGG - Intergenic
1052651179 9:31303406-31303428 AATGTCCATCAGCAGATGGATGG - Intergenic
1052774765 9:32722398-32722420 AGTTTTCTAGGGCAGGTGGAAGG - Intergenic
1054715050 9:68548493-68548515 AATTTCCTGCAGCAGCTGGGTGG + Intergenic
1055315785 9:75032551-75032573 AATGTCCTTCAGCAGATGAATGG + Intergenic
1056701533 9:88915262-88915284 ACTTTTCTAGAGCAGGTGGGAGG - Intergenic
1058672758 9:107374397-107374419 ATTTTGCTTGAGCAAATGGAAGG + Intergenic
1060368019 9:123039535-123039557 AATAACCTAGACCAAATGGAAGG - Intronic
1060667726 9:125442792-125442814 AATTTAAAAGAGCAGCTGGAAGG - Intronic
1060748732 9:126155008-126155030 CATTTCCTCGAGCAGCTGGGGGG - Intergenic
1060944386 9:127561297-127561319 AACTTCCTGGAGCACATGGCAGG + Intronic
1187668753 X:21646762-21646784 AATTTCATAGAGTAGAGGGTGGG - Intronic
1189057798 X:37716886-37716908 AAGTTGCTAGGGCAGATAGAGGG + Intronic
1189648186 X:43157542-43157564 ACTTCCCTAGAACACATGGAGGG - Intergenic
1190444751 X:50513417-50513439 AATGTCCTAAAGCAGATGAATGG + Intergenic
1190799571 X:53775053-53775075 ATTGACCTAGAGAAGATGGAAGG + Intergenic
1190826469 X:54022512-54022534 AAGTTCCTGGTGAAGATGGATGG + Intronic
1191829547 X:65401675-65401697 ACTCTCCTAAAGCAGAAGGAAGG - Intronic
1193505606 X:82338559-82338581 AATTTCCCAAAGCAAATGAAAGG - Intergenic
1197465414 X:126799063-126799085 CCTTTCCTCAAGCAGATGGAGGG - Intergenic