ID: 989162707

View in Genome Browser
Species Human (GRCh38)
Location 5:38406973-38406995
Sequence CCATTCCCATACAGAGAAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 381}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989162689_989162707 24 Left 989162689 5:38406926-38406948 CCCCCCTACCTCAGCATCTCTCC 0: 1
1: 0
2: 6
3: 55
4: 589
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162698_989162707 2 Left 989162698 5:38406948-38406970 CCTGTGACCACGGTGGCTCCCCA 0: 1
1: 0
2: 0
3: 16
4: 123
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162694_989162707 16 Left 989162694 5:38406934-38406956 CCTCAGCATCTCTCCCTGTGACC 0: 1
1: 0
2: 2
3: 51
4: 421
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162690_989162707 23 Left 989162690 5:38406927-38406949 CCCCCTACCTCAGCATCTCTCCC 0: 1
1: 0
2: 12
3: 100
4: 876
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162693_989162707 20 Left 989162693 5:38406930-38406952 CCTACCTCAGCATCTCTCCCTGT 0: 1
1: 0
2: 4
3: 45
4: 588
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162699_989162707 -5 Left 989162699 5:38406955-38406977 CCACGGTGGCTCCCCAGCCCATT 0: 1
1: 0
2: 0
3: 19
4: 180
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162697_989162707 3 Left 989162697 5:38406947-38406969 CCCTGTGACCACGGTGGCTCCCC 0: 1
1: 0
2: 2
3: 7
4: 126
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162691_989162707 22 Left 989162691 5:38406928-38406950 CCCCTACCTCAGCATCTCTCCCT 0: 1
1: 0
2: 3
3: 59
4: 624
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381
989162692_989162707 21 Left 989162692 5:38406929-38406951 CCCTACCTCAGCATCTCTCCCTG 0: 1
1: 0
2: 2
3: 44
4: 511
Right 989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 27
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989162707 Original CRISPR CCATTCCCATACAGAGAAAG GGG Exonic
902846687 1:19116360-19116382 CCATTCCCCTCCAGAGGAGGTGG - Intronic
905496180 1:38389788-38389810 CCATTCCAAAAGAGAGAAATTGG + Intergenic
908879116 1:68710635-68710657 CCATTCCAAAAGAGAGAAATTGG - Intergenic
909239301 1:73191855-73191877 CCATTCTCAAACAGAAAAATAGG - Intergenic
909808736 1:79905298-79905320 CCATTCCAAAAGAGAGAAATTGG + Intergenic
910083488 1:83371317-83371339 CCATTCCAATAGGGAGAAATTGG + Intergenic
910689852 1:89954746-89954768 CCATTCTCAAAAAGAGAAAGTGG - Intergenic
912210610 1:107552816-107552838 CCATCCCCACACAGATACAGAGG + Intergenic
912278750 1:108290299-108290321 CCATTCCAAAAGGGAGAAAGAGG + Intergenic
912289476 1:108404058-108404080 CCATTCCAAAAGGGAGAAAGAGG - Intronic
912615588 1:111096825-111096847 CCATTCCAAAAGAGAGAAATTGG + Intergenic
913931329 1:124967620-124967642 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
913964446 1:143363786-143363808 GGATTCCCATACAGAAAATGCGG - Intergenic
914058815 1:144189392-144189414 GGATTCCCATACAGAAAATGCGG - Intergenic
914120334 1:144776979-144777001 GGATTCCCATACAGAAAATGCGG + Intergenic
915276579 1:154792958-154792980 CATTTCCCAGCCAGAGAAAGGGG + Intronic
916333668 1:163645795-163645817 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
916850767 1:168701016-168701038 CCTTTCCACTGCAGAGAAAGTGG + Exonic
917379065 1:174383569-174383591 CCTTTCCCAGTCAAAGAAAGCGG - Intronic
917384725 1:174459417-174459439 CCAATCCCACACAGATAATGAGG - Intronic
917677146 1:177330533-177330555 CCACTCACACACAGAGAAAAAGG - Intergenic
919177127 1:194033184-194033206 CCATTCCCAAAGGGAGAAATTGG + Intergenic
920462026 1:206148075-206148097 CATTTCCCATACAGGGAAACTGG - Intergenic
920995657 1:210988183-210988205 CCTTTCCTAGTCAGAGAAAGGGG - Intronic
922060715 1:222088675-222088697 CCATTCCAAACCTGAGAAAGGGG - Intergenic
923992776 1:239457161-239457183 CTATGGCCATACAAAGAAAGGGG - Intronic
924858016 1:247894100-247894122 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1062895200 10:1097793-1097815 CCTTTCCAAAAGAGAGAAAGAGG - Intronic
1062921002 10:1279744-1279766 CCTTTCCAAGAGAGAGAAAGAGG - Intronic
1062966849 10:1614527-1614549 CCCATCCCATACAGAAAAATAGG + Intronic
1063622796 10:7664900-7664922 TCATCCCCATACAGAGATAGAGG + Intronic
1063877405 10:10494397-10494419 CTATTCCCACTCAGAGAAATGGG + Intergenic
1065816875 10:29490804-29490826 CCATTCCCAAACACAGAAGCAGG + Intronic
1065955972 10:30693689-30693711 CCATTCCCAAACACAGAAGCAGG - Intergenic
1066110015 10:32187641-32187663 CCTCCCCCATACAGAGACAGAGG + Intergenic
1066177093 10:32919245-32919267 CTATTCTTTTACAGAGAAAGCGG + Intronic
1068718096 10:60210702-60210724 CCATTCCCACACACACAATGGGG + Intronic
1069055158 10:63837212-63837234 GCATTCTCATTCAGAAAAAGAGG + Intergenic
1069707293 10:70466934-70466956 CCATTTCCTTACAGGGAGAGAGG - Intergenic
1070731629 10:78832426-78832448 CCATTCCCTTAAAGAGAAGTGGG + Intergenic
1071360788 10:84844063-84844085 CAATACACATAAAGAGAAAGGGG - Intergenic
1071884067 10:89930526-89930548 CCATTCCAAAAGAGAGAAATAGG - Intergenic
1073604456 10:104879934-104879956 CCAATCCCATCCTGAGAAAGAGG - Intronic
1074693352 10:116026543-116026565 CCAGCCCCACACAGAGACAGAGG - Intergenic
1075077193 10:119359354-119359376 CCATAACCATGGAGAGAAAGTGG - Intronic
1077673260 11:4176026-4176048 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1078979845 11:16520714-16520736 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1080171449 11:29307930-29307952 CCAATCCCAGAGAGAGAAGGAGG - Intergenic
1080211754 11:29794685-29794707 CCTTTCCTATTCAAAGAAAGGGG + Intergenic
1081039362 11:38191967-38191989 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1082634238 11:55577383-55577405 CCTTTCCTATTCAAAGAAAGAGG + Intergenic
1082963519 11:58941820-58941842 CCAATCTCATTTAGAGAAAGAGG - Intronic
1082970477 11:59015463-59015485 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1083014552 11:59439676-59439698 CCAGTCCCAGAAACAGAAAGTGG - Intergenic
1086744304 11:90405852-90405874 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1087330796 11:96777574-96777596 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1087520593 11:99230141-99230163 CCATTCCCATTGGGAGAAAATGG - Intronic
1088528846 11:110786287-110786309 CCATTCCAAAAGAGAGAAATTGG - Intergenic
1088885468 11:114002969-114002991 CCATTGCCACTCAGAGGAAGGGG - Intergenic
1090728815 11:129551947-129551969 CCATTCCCAAAGTGAGAAATTGG - Intergenic
1091274093 11:134338432-134338454 CCAGTCCCATTCCCAGAAAGAGG + Intronic
1092324050 12:7510192-7510214 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1093571206 12:20668060-20668082 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1093609614 12:21137738-21137760 CCTTTCCTAGTCAGAGAAAGGGG - Intronic
1093615278 12:21214843-21214865 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1094397535 12:30024484-30024506 CCATTCCAATAGAAAGAAATTGG + Intergenic
1095867094 12:46983848-46983870 CCATCCCCATGCAGAGAACTTGG + Intergenic
1095908049 12:47397538-47397560 CCATCCCCATCCAGAGAACTTGG + Intergenic
1096279148 12:50236663-50236685 GCTTCCCCATACAGAGACAGAGG - Intronic
1097692070 12:62742843-62742865 CCATTCCCATACAGAGGGGATGG + Intronic
1098463917 12:70765246-70765268 CCTTTCCTATTCAAAGAAAGGGG + Intronic
1098602316 12:72346539-72346561 CCATTCCCAGGCAGACAAATTGG - Intronic
1099743356 12:86669519-86669541 CCATCCCCATGCAGAGAATTGGG + Intronic
1100753400 12:97724063-97724085 CCATTCCGAGTCAAAGAAAGGGG + Intergenic
1101169001 12:102068717-102068739 CCATTCACATTCAGAGATAGTGG - Intergenic
1101611831 12:106299679-106299701 CAACTCCCATAGAGAGAAATAGG + Intronic
1102614651 12:114142774-114142796 CTATTGCCATACAGTGAAATAGG - Intergenic
1103453210 12:121044186-121044208 CCATTCCCAAGGAGAGAAGGAGG + Intergenic
1105072694 12:133245167-133245189 CCTTTCCTAGACAAAGAAAGGGG + Intergenic
1105538899 13:21297654-21297676 CCATTCCAAAAGAGAGAAAGGGG + Intergenic
1105731704 13:23224076-23224098 CCAGTCACATACATAGAAAATGG - Intronic
1105799360 13:23889902-23889924 CCATTCCAAAAGAGAGAAAGGGG - Intergenic
1106300949 13:28464953-28464975 CCACTCCCCTATAGAGACAGGGG + Intronic
1107423559 13:40271813-40271835 CCAGTCCAAGCCAGAGAAAGGGG + Intergenic
1108174867 13:47782113-47782135 CCATTCCGAGTCAAAGAAAGGGG + Intergenic
1108565837 13:51696081-51696103 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1109906325 13:68846485-68846507 CCATTCCCAAAGGGAGAAATTGG - Intergenic
1110817446 13:79877646-79877668 CCCTTACTATATAGAGAAAGGGG - Intergenic
1110952622 13:81515754-81515776 GCTTCCCCATACAGAGAAAGAGG + Intergenic
1111318135 13:86587085-86587107 CCATTCCAAAAGAGAGAAATCGG - Intergenic
1111466883 13:88624754-88624776 CTTTTCTCACACAGAGAAAGGGG + Intergenic
1111513639 13:89298315-89298337 CCATTCCAAAAGAGAGAAATAGG - Intergenic
1111708246 13:91778447-91778469 CCAGTCCCATACAGAAAGAATGG - Intronic
1111992610 13:95132104-95132126 CCAATCCCACACAGATAGAGAGG - Intronic
1112555253 13:100461840-100461862 CTTTTCCCCTCCAGAGAAAGTGG - Intronic
1113122158 13:106935116-106935138 CCTTTCCGAGACAAAGAAAGGGG - Intergenic
1113206854 13:107926459-107926481 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1114801893 14:25784633-25784655 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1114828198 14:26106635-26106657 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1114982914 14:28188666-28188688 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1114993577 14:28318282-28318304 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1115309289 14:31963281-31963303 CCATTCCCGTGCAGAGTAAATGG - Intergenic
1115958982 14:38813358-38813380 CTATTCCAAGAGAGAGAAAGAGG + Intergenic
1116322797 14:43492402-43492424 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1117402204 14:55368681-55368703 TCAATCCCATAGAAAGAAAGTGG + Exonic
1117477027 14:56106022-56106044 TCATTCCAATGGAGAGAAAGTGG - Intergenic
1117559602 14:56923292-56923314 CCATTCCAAAAGAGAGAAAGAGG - Intergenic
1117802209 14:59456045-59456067 CCATTCCAAGAAAGAGAAAAGGG - Intronic
1117824505 14:59687741-59687763 CCATTCCTATACAGAGATCCTGG + Intronic
1119379317 14:74218536-74218558 CCATTCCCAGAGGGAGACAGGGG - Intergenic
1120121083 14:80680719-80680741 CCATCACCATGCAGAGAAATTGG + Intronic
1120234700 14:81876692-81876714 CCATTCCCAAAGGGAGAAATTGG - Intergenic
1121881385 14:97503359-97503381 CCATTCCAAAACAGAGAAACAGG - Intergenic
1122285472 14:100649185-100649207 CCATTCCCAAACGGAAAAATAGG - Intergenic
1122397815 14:101446771-101446793 CCATTCCCACCAAGAGGAAGAGG + Intergenic
1123501191 15:20882609-20882631 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123510774 15:20996991-20997013 CCTTTCCCTTACACACAAAGTGG + Intergenic
1123558443 15:21456314-21456336 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123567994 15:21570748-21570770 CCTTTCCCTTACACACAAAGTGG + Intergenic
1123594674 15:21893589-21893611 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123604102 15:22006072-22006094 CCTTTCCCTTACACACAAAGTGG + Intergenic
1123769300 15:23512588-23512610 CCATTCCAAAAGAGAGAAATGGG + Intergenic
1124505585 15:30270332-30270354 CCAGTCCAGAACAGAGAAAGAGG - Intergenic
1124737968 15:32268300-32268322 CCAGTCCAGAACAGAGAAAGAGG + Intergenic
1125261541 15:37831329-37831351 TCTTTCCCATAAAGAGAAAGTGG + Intergenic
1130205436 15:81870893-81870915 CCATTCCGAGTCAAAGAAAGGGG + Intergenic
1130706313 15:86236693-86236715 GCCTCCCCATACAGAGACAGAGG + Intronic
1202966793 15_KI270727v1_random:183464-183486 TCCTTCCCATACAGAGAACTGGG - Intergenic
1202976353 15_KI270727v1_random:297839-297861 CCTTTCCCTTACACACAAAGTGG + Intergenic
1134283525 16:12839309-12839331 CCATTCCCATAGAGAGAAAATGG - Intergenic
1136411423 16:30079693-30079715 CCTCTGCCATACAGAGCAAGGGG + Intronic
1136515052 16:30763044-30763066 CCAATCACAGAGAGAGAAAGAGG - Intronic
1139342660 16:66278540-66278562 CCCTTCCCATACAGAGAATTGGG + Intergenic
1140317902 16:73917148-73917170 CCATTTACAAGCAGAGAAAGAGG + Intergenic
1143826837 17:9616211-9616233 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1144012380 17:11161853-11161875 GCTTCCCCATACAGAGACAGAGG - Intergenic
1144751709 17:17653381-17653403 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1145201779 17:20951830-20951852 CAATTCCCTTCCAGAGAAAATGG - Intergenic
1147464450 17:40599873-40599895 CCAGCCCCATAGAGAGAAAGGGG - Intergenic
1148126533 17:45240375-45240397 CCACTGCCATCCAGAGGAAGGGG - Intronic
1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG + Exonic
1149235142 17:54580916-54580938 CCACTCTCATAGAGAGAAATAGG + Intergenic
1151083735 17:71357644-71357666 CCTTTCCTAGTCAGAGAAAGGGG - Intergenic
1152877679 17:82796459-82796481 CCATTTCGCTAAAGAGAAAGGGG + Intronic
1153164575 18:2247392-2247414 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1153196400 18:2602739-2602761 GCACTCCCATATAGAGAAAAAGG + Intronic
1153415350 18:4840148-4840170 CAATTCCCATCCAAAAAAAGAGG + Intergenic
1153470849 18:5443624-5443646 CCATTCACAGGCAGAGAAACAGG + Intronic
1154005423 18:10523516-10523538 CCTCCCCCATACAGAGACAGAGG + Intergenic
1156376640 18:36520789-36520811 CCATTCCTACACAGAGAGTGTGG + Intronic
1156426526 18:37019600-37019622 CCATCCCCATGCAGAGAACTTGG - Intronic
1158347001 18:56525789-56525811 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1159569033 18:70090980-70091002 CCATTCCAAAAGAGAGAAATAGG - Intronic
1160623189 18:80185151-80185173 CCTTTCCCATACAGTCTAAGGGG + Intronic
1162577653 19:11508084-11508106 CCAATCCCCTACAGAGGAACTGG + Intronic
1163383334 19:16983110-16983132 CCATGCCCAGCCAGAAAAAGAGG - Intronic
1164122096 19:22275277-22275299 GCTTTCTCATGCAGAGAAAGTGG + Intergenic
1164729623 19:30493341-30493363 GCATGCCCATGCAGAGAACGAGG + Intronic
1165270843 19:34706262-34706284 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1165419073 19:35713925-35713947 ACATTCCCATCCAGAGAAAGAGG - Intronic
1165826759 19:38710022-38710044 CCATTCTCAGAGAGAGGAAGTGG + Intronic
1167529674 19:50007483-50007505 CCATTCCCATTCTCAGAACGGGG + Intronic
1168462247 19:56568554-56568576 CCACTCCAATAAAGAGAAAGGGG + Intronic
1202698218 1_KI270712v1_random:141277-141299 GGATTCCCATACAGAAAATGCGG - Intergenic
925431687 2:3800148-3800170 CCTTTCCTAGTCAGAGAAAGTGG - Intronic
925483064 2:4297894-4297916 CCATTCCCAAAGTGAGACAGAGG - Intergenic
925997277 2:9303836-9303858 TAACCCCCATACAGAGAAAGTGG + Intronic
927152700 2:20204864-20204886 CCAGTCCCCCACAGGGAAAGGGG + Intronic
927250730 2:20993002-20993024 TCATTCCCATACTGAGGAAAGGG + Intergenic
929247466 2:39718700-39718722 CCAAACCCACACAGAGAAAAAGG - Intergenic
930254674 2:49076764-49076786 CCATTCCAAATGAGAGAAAGTGG + Intronic
930427062 2:51225750-51225772 CTATTTCCATTCAGAGACAGTGG - Intergenic
930760141 2:55025134-55025156 TCCTTCCGATACAGAAAAAGAGG - Exonic
930972889 2:57418933-57418955 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
931048823 2:58387320-58387342 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
932035193 2:68238382-68238404 CGTTTGCCAGACAGAGAAAGGGG + Intronic
932520186 2:72403950-72403972 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
933195270 2:79382383-79382405 ACATACCCAGACAGAGAGAGAGG - Intronic
933592246 2:84246022-84246044 CCAATCACAGAGAGAGAAAGAGG + Intergenic
934220519 2:90078068-90078090 CCTCCCCCATACAGAGACAGGGG + Intergenic
934233151 2:90205297-90205319 GCTTCCCCATACAGAGACAGAGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935741323 2:106151022-106151044 CCATTCCAAAAGAGAGAAATAGG - Intronic
936283597 2:111163556-111163578 TCCTTCCCATACCGAGAAGGTGG + Intronic
936904892 2:117525611-117525633 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
936905811 2:117534456-117534478 CCATTCCAAAAGAGAGAAATTGG - Intergenic
937752741 2:125497482-125497504 CCTTCCCCGTACAGAGACAGAGG - Intergenic
937826251 2:126371476-126371498 TCATGCCCAGAGAGAGAAAGAGG - Intergenic
938657603 2:133450383-133450405 CCAGTCCAATGCAGAGGAAGAGG + Intronic
939924370 2:148154711-148154733 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
940055322 2:149507158-149507180 CCTTTCCTAGACAAAGAAAGGGG - Intergenic
940451492 2:153843759-153843781 CCATTCCCAAAGTGAGAAATTGG + Intergenic
940608983 2:155966112-155966134 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
940985886 2:160051838-160051860 ACATTTCCATGCAGAGAGAGAGG - Intronic
942486189 2:176442397-176442419 CAATTCCTCTAAAGAGAAAGAGG + Intergenic
943061935 2:183048610-183048632 CCTCTCCCATCCAGTGAAAGTGG - Intergenic
943627410 2:190215946-190215968 TCATGCCCAGAGAGAGAAAGAGG + Intronic
944007245 2:194924856-194924878 GCTTTCTCATACAGAGAAAGCGG + Intergenic
944262564 2:197693314-197693336 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
945494922 2:210498706-210498728 CCATCCCCATGCAGAGAACTTGG - Intronic
946009706 2:216554853-216554875 TCAGTCCCATGGAGAGAAAGTGG + Intronic
946659532 2:221984787-221984809 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
947197619 2:227584329-227584351 CCATTCCAAAAGAGAGAAACTGG - Intergenic
1169766250 20:9151325-9151347 CCATTCCCTTACAGATACTGAGG + Intronic
1170319375 20:15078369-15078391 CAATGTCCATACAGAGAAGGGGG + Intronic
1170387658 20:15837355-15837377 TCATTCCCACACGGAGAAAAGGG - Intronic
1170503953 20:17004622-17004644 CCTTTCACTTACAGAGAATGGGG - Intergenic
1170538574 20:17365712-17365734 CCATTCCCAAAGGGAGAAATAGG + Intronic
1171257506 20:23701277-23701299 CCCTTCCTGTACAGAGACAGTGG + Intergenic
1171264921 20:23763436-23763458 CCCTTCCTGTACAGAGACAGTGG + Intergenic
1171407559 20:24921925-24921947 CCTTTCCTAGTCAGAGAAAGGGG + Intergenic
1171910725 20:30949894-30949916 CCATTCCAAGTCAAAGAAAGGGG - Intergenic
1171941349 20:31332936-31332958 CCTTTCCTAGTCAGAGAAAGGGG + Intergenic
1174183212 20:48687874-48687896 TATTTCCCAAACAGAGAAAGTGG + Intronic
1175497143 20:59423032-59423054 CCACACCCACACAGGGAAAGGGG - Intergenic
1178784509 21:35640582-35640604 CCATTCCCTTACATAGCAACTGG + Intronic
1179361627 21:40714555-40714577 CCATTCCAAAAAGGAGAAAGAGG - Intronic
1181523325 22:23461914-23461936 CCATTCACAAACACAGACAGGGG + Intergenic
1182632752 22:31699971-31699993 TCATTCCAATATACAGAAAGGGG - Intronic
1183262937 22:36807664-36807686 CCATTCCCACACCTGGAAAGTGG - Intronic
1184435765 22:44474226-44474248 CCATTCCAAAAGAGAGAAATAGG - Intergenic
1185131215 22:49040069-49040091 CAATTCCCATACACAGAACTTGG + Intergenic
1185240101 22:49737769-49737791 CCATTCCCACATACACAAAGAGG + Intergenic
949666086 3:6341045-6341067 CCATTCCTAGTCAAAGAAAGGGG + Intergenic
950583888 3:13879762-13879784 CCATGCCCAGGCTGAGAAAGAGG + Exonic
951157821 3:19376378-19376400 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
951159987 3:19407620-19407642 CCATTCCTAGACATAGATAGTGG + Intronic
951335957 3:21422004-21422026 CCATTTGCATAAAGAAAAAGTGG - Intronic
951497739 3:23349469-23349491 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
952612287 3:35226041-35226063 CCTTTCCTAGACAAAGAAAGGGG + Intergenic
953151179 3:40326465-40326487 CCATTTCCATATATATAAAGTGG + Intergenic
955135774 3:56216596-56216618 CTATTCCCATCAATAGAAAGAGG + Intronic
955268915 3:57477165-57477187 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
956390236 3:68764229-68764251 CCATACCCCCACAGAGAAAGAGG + Intronic
956684296 3:71810024-71810046 CCATTCCCCATCACAGAAAGTGG - Intergenic
957207482 3:77216476-77216498 CCTTTCCTAGTCAGAGAAAGGGG - Intronic
957495191 3:80982846-80982868 CCATTCCCAAAGGGAGAAACTGG - Intergenic
957903802 3:86532919-86532941 CTATTCCAAAACAGAGAAATTGG + Intergenic
958175916 3:89996200-89996222 CCTTTCCCAATCAAAGAAAGGGG + Intergenic
960922295 3:122759398-122759420 GCATTACCATACAGAGAAGTTGG - Intronic
961411782 3:126727409-126727431 CAATTCCCACATGGAGAAAGTGG - Intronic
962314605 3:134351226-134351248 CCATTGCCATTCACTGAAAGTGG - Intergenic
962686579 3:137853653-137853675 CCAGACCCAGAGAGAGAAAGTGG - Intergenic
963435247 3:145258389-145258411 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
964325548 3:155542121-155542143 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
964481270 3:157140853-157140875 ACATACACATACAGAGAAAAAGG + Intergenic
965891494 3:173519638-173519660 CCATTCCAAAAGAGAGAAATTGG - Intronic
965901558 3:173646386-173646408 ACATTCCTAACCAGAGAAAGTGG - Intronic
966074327 3:175918901-175918923 CCATTCCAAAACAGAGAAATTGG + Intergenic
968680841 4:1918394-1918416 GCATTCCCATGAAGAGAAGGCGG + Exonic
969031280 4:4216837-4216859 GGATTCCCATACAGAAAATGCGG + Intronic
969151818 4:5176201-5176223 CCTTTCCCAGACAAAGAAAGGGG - Intronic
969988413 4:11235453-11235475 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
970078322 4:12250702-12250724 CCATTTCTATACAGAGGATGAGG + Intergenic
971748866 4:30620230-30620252 CTATTCCCTTACACAGTAAGTGG + Intergenic
972012925 4:34206580-34206602 CCATTCCAAATCAGAGAAACTGG - Intergenic
972367881 4:38393063-38393085 CCATTCCAAAAGAGAGAAAGGGG - Intergenic
972542456 4:40051181-40051203 CCATTCATGTACAGAGAAACTGG + Intergenic
973748045 4:53983981-53984003 CCATTCCAGTGCAGGGAAAGAGG - Intronic
973780311 4:54282846-54282868 CCATTCCCAAAGGGAGAAATCGG + Intronic
973824549 4:54691941-54691963 CTCTTCCCATACATAGGAAGTGG + Intronic
974780328 4:66545303-66545325 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
974897680 4:67958510-67958532 CCATTCCAAATCAGAGAAATTGG - Intronic
974917271 4:68194285-68194307 CCTTTCCTAGTCAGAGAAAGGGG + Intergenic
975066249 4:70067714-70067736 CCATTTCCAGACGGAGAAAGTGG - Intergenic
975327543 4:73077076-73077098 GCATTCCCATACACAGAAAAAGG + Exonic
975753860 4:77552736-77552758 CCATCCCCATGCAGAGAACTTGG - Intronic
977130172 4:93226380-93226402 CTATTCCAAAACAGAGAAATAGG + Intronic
977159369 4:93614091-93614113 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
977353268 4:95914985-95915007 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
977596673 4:98889804-98889826 TCATTCTCCTACAGAGAAAAAGG - Intronic
977764217 4:100777848-100777870 CCCTTCCAATACAGAGATTGTGG - Intronic
979139399 4:117153088-117153110 CCATTCCCATACAGAGAATTTGG - Intergenic
979270800 4:118759209-118759231 TTATTCCCATATAGAGAAATGGG - Intronic
979381471 4:120011596-120011618 CCATCCCCAGACATAGAAGGCGG - Intergenic
980264083 4:130492904-130492926 CCATTCCCAAAGGGAGAAATTGG - Intergenic
980600866 4:135022356-135022378 GGATCCCCATACAGAGACAGAGG - Intergenic
981618046 4:146663511-146663533 CCTTTCCGATTCAAAGAAAGGGG + Intergenic
981839520 4:149094486-149094508 CCATTCCTAGTCAAAGAAAGGGG - Intergenic
981987507 4:150875350-150875372 CCATTCCCATGCAGAGAACTTGG + Intronic
982581201 4:157180670-157180692 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
982838890 4:160157089-160157111 CCTTTCCTAGTCAGAGAAAGGGG - Intergenic
983140318 4:164142033-164142055 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
984083327 4:175277752-175277774 GCTTTCTCATACAGAGAAAGTGG + Intergenic
984696457 4:182784834-182784856 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
984741541 4:183168747-183168769 CCATTCTCATTCAGTGAAATAGG + Intronic
987234651 5:15930524-15930546 CCATTCCCAAATAGCAAAAGTGG - Intronic
987894268 5:23925197-23925219 CCATTCCAAATCAGAGAAATTGG + Intergenic
988026447 5:25697640-25697662 CTACTCCCATGCTGAGAAAGTGG - Intergenic
988646602 5:33101800-33101822 CCTTTCCTATTCAAAGAAAGGGG - Intergenic
989138093 5:38175282-38175304 CCATTCCTAGTCAAAGAAAGGGG - Intergenic
989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG + Exonic
989679669 5:44014017-44014039 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
993243003 5:85415027-85415049 CAGTTCCACTACAGAGAAAGTGG + Intergenic
993742013 5:91553310-91553332 CCATTCCAAAAGAGAGAAATTGG - Intergenic
994632390 5:102302153-102302175 ACCTTCCCATAAAGAAAAAGTGG + Intergenic
994777849 5:104057862-104057884 CTATTCCAAAATAGAGAAAGAGG - Intergenic
995313956 5:110745562-110745584 GCATTACTTTACAGAGAAAGTGG - Intronic
995318529 5:110804020-110804042 CCATTCCTGTACAGAGATTGTGG - Intergenic
995334718 5:110985956-110985978 CCATTCCTAGTCAAAGAAAGGGG + Intergenic
995492240 5:112705650-112705672 CCCTTCCCATCTAGAGAAATTGG - Intergenic
996401994 5:123072726-123072748 GCATTTCAATACAGACAAAGAGG + Intergenic
996512989 5:124338278-124338300 CCATTCCAAAAGGGAGAAAGAGG + Intergenic
996611283 5:125383013-125383035 CCATTCCCAAAAGGAGAAATTGG - Intergenic
999606835 5:153325552-153325574 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
999986144 5:157007356-157007378 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1000965737 5:167653898-167653920 CCATTCTCCAACAGACAAAGTGG - Intronic
1001969133 5:175939578-175939600 CCTTTCTCACTCAGAGAAAGGGG + Intronic
1002248307 5:177904165-177904187 CCTTTCTCACTCAGAGAAAGGGG - Intergenic
1003813418 6:9810976-9810998 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005259226 6:24040011-24040033 CCTTTGGGATACAGAGAAAGCGG - Intergenic
1007744561 6:44035388-44035410 CCATTCCTTTAGAGAGAATGAGG - Intergenic
1008255699 6:49297219-49297241 ACATTGGCAGACAGAGAAAGTGG + Intergenic
1008848123 6:55993197-55993219 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1010517325 6:76789515-76789537 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1010740335 6:79495363-79495385 CCAATCCCCTACAGACACAGAGG - Intronic
1010834867 6:80573699-80573721 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1012251579 6:96986772-96986794 CCATTCCTAGTCAAAGAAAGGGG - Intronic
1012858503 6:104530551-104530573 CCATTGCCCTAAAGAGAAATAGG - Intergenic
1014381490 6:120748577-120748599 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1015261294 6:131240807-131240829 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1015942036 6:138462391-138462413 CCAATCCCATCAAGAGAGAGAGG + Intronic
1016213290 6:141566331-141566353 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1016226552 6:141746247-141746269 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1016231788 6:141815040-141815062 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1016284763 6:142461178-142461200 ACATTCCAAGACAGAGAAAATGG - Intergenic
1016301356 6:142635415-142635437 CCATTCTCAAAGAGAGAAATTGG + Intergenic
1020881297 7:13765868-13765890 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1020884667 7:13806491-13806513 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1021374545 7:19889863-19889885 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1021519757 7:21527322-21527344 CCATTCCAAAAAAGAGAAATTGG - Intergenic
1021754810 7:23841950-23841972 ACATTCCTATACATAAAAAGAGG - Intergenic
1022089319 7:27097161-27097183 ACATTCCCCTCCAGAAAAAGAGG - Intergenic
1023029478 7:36079839-36079861 ACATTCCCAGACAGTGACAGGGG - Intronic
1024405105 7:48969983-48970005 CCATTCCTGTGCAGAGATAGTGG + Intergenic
1026732943 7:72927027-72927049 ACATTCCCATATAGATACAGAGG + Intronic
1027300318 7:76827458-76827480 CCATTCCAATAGGGAGAAATTGG + Intergenic
1029169371 7:98619872-98619894 CCACTGCCAGACAGAGAAACAGG - Intronic
1029834268 7:103292706-103292728 CCCTTCCCATAAAAAGAAAAAGG + Intergenic
1030002251 7:105077914-105077936 CCATTCCAATACCAACAAAGTGG - Intronic
1030893713 7:115030867-115030889 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1032137613 7:129295152-129295174 AAATTCCCTTTCAGAGAAAGAGG - Intronic
1032514400 7:132496013-132496035 CCATCCCCACACTGGGAAAGAGG - Intronic
1032823246 7:135544135-135544157 CCAGTCCAATCCAGAGACAGGGG + Intergenic
1033672785 7:143509319-143509341 CAATTTCTATACAGGGAAAGTGG - Intergenic
1033816982 7:145085215-145085237 CCATGCACAGACAGAGAGAGGGG + Intergenic
1033843578 7:145404236-145404258 CCATTCCAAAACGGAGAAATTGG - Intergenic
1034732440 7:153399646-153399668 AAATGCCCACACAGAGAAAGTGG - Intergenic
1035864600 8:3069114-3069136 CCATTCCAATAGGGAGAAATTGG + Intronic
1035948108 8:3987660-3987682 CAGTTCCCAGACAGAGAAAATGG + Intronic
1037092752 8:14943517-14943539 CCATTCTCATAGATGGAAAGAGG - Intronic
1038438471 8:27555188-27555210 CCTTTCCTAGACAAAGAAAGGGG - Intergenic
1038945059 8:32350021-32350043 ACATTCCAACACAGAGAAATAGG + Intronic
1039647707 8:39305553-39305575 CCATTCCAAAAGAGAGAAATAGG + Intergenic
1040098974 8:43480288-43480310 CCATTCCTATTCAAAGAAAGGGG + Intergenic
1040565021 8:48557108-48557130 CCATTCCCTGTCATAGAAAGAGG - Intergenic
1042005158 8:64171641-64171663 CCATTTTCATACAGACAAGGAGG + Intergenic
1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG + Intergenic
1042682928 8:71406586-71406608 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1042779893 8:72479659-72479681 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1043045904 8:75324444-75324466 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1044804388 8:95990238-95990260 CCATTCACATTCAGAGATAAAGG + Intergenic
1045592024 8:103608771-103608793 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1046357663 8:113109474-113109496 CCATTCCAATAGGGAGAAACAGG + Intronic
1046422726 8:114006072-114006094 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1048362588 8:133710958-133710980 CCATTCCTAGCCATAGAAAGAGG + Intergenic
1048461768 8:134627047-134627069 CCAATGGCATACAGAGACAGTGG + Intronic
1050374193 9:4953607-4953629 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1050490455 9:6182982-6183004 CCTTTCCTAGTCAGAGAAAGGGG - Intergenic
1050674438 9:8036381-8036403 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1053089821 9:35264865-35264887 CCATTCCAAAAGAGAGAAACAGG - Intronic
1054752081 9:68917607-68917629 CCATTCCCTCAAAGAGAAAGAGG + Exonic
1056484496 9:87042100-87042122 CCTTTCCTAGTCAGAGAAAGGGG + Intergenic
1058079952 9:100690939-100690961 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1058143992 9:101390329-101390351 ACATTCCTCTACAGAAAAAGTGG + Exonic
1058211432 9:102174401-102174423 CCTTTCCTATTCAAAGAAAGGGG - Intergenic
1059007291 9:110417328-110417350 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1059877202 9:118647741-118647763 CCATTCCAAAAAAGAGAAATAGG - Intergenic
1059921946 9:119169341-119169363 CCTTTCCGAAACAAAGAAAGGGG + Intronic
1061429642 9:130523099-130523121 CCACTCCCATCCAGAGGAAGGGG - Intergenic
1203775293 EBV:69579-69601 CCATCGCCCCACAGAGAAAGAGG - Intergenic
1187421966 X:19142894-19142916 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1187589133 X:20696758-20696780 CTATTCCAAAACAGAGAAAGAGG + Intergenic
1187645185 X:21339690-21339712 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1187673672 X:21693786-21693808 TCATTCCCAGACATAGAAAAAGG + Intergenic
1187836621 X:23437785-23437807 CCATTCCAAAAGGGAGAAAGAGG - Intergenic
1188174899 X:26977206-26977228 CCATCGCCAAAAAGAGAAAGAGG - Intergenic
1190130352 X:47742232-47742254 CCATTCCAAAACGGAGAAATGGG + Intergenic
1190907216 X:54739006-54739028 CCATTCCTAGTCAAAGAAAGGGG - Intergenic
1190942183 X:55052709-55052731 CCATTCCTAGTCAAAGAAAGGGG - Intergenic
1191049695 X:56178001-56178023 CCTTTCCCAGCCAAAGAAAGGGG - Intergenic
1191266219 X:58396988-58397010 CCTTTCCTATTCAAAGAAAGGGG - Intergenic
1191704962 X:64084759-64084781 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1192042023 X:67632419-67632441 CCATTCCTAGTCAAAGAAAGGGG - Intronic
1192565278 X:72158338-72158360 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1192919057 X:75686290-75686312 CCTTTCCTAGACAAAGAAAGGGG - Intergenic
1193033487 X:76924585-76924607 CCTTTCCTATTCAAAGAAAGGGG + Intergenic
1193426428 X:81345660-81345682 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1193827371 X:86242409-86242431 CCATTCCAAAACGGAGAAATTGG - Intronic
1196638464 X:118031953-118031975 CCTTTCCTAGTCAGAGAAAGGGG + Intronic
1197390835 X:125861602-125861624 CTATTCCTGTACAGAGAATGTGG + Intergenic
1197444674 X:126536742-126536764 CAATTCCGATACACACAAAGAGG + Intergenic
1197545546 X:127819489-127819511 CTATTCCAAGATAGAGAAAGAGG + Intergenic
1197793086 X:130274624-130274646 CCATACTCATACTGAGAAAAAGG - Intergenic
1197919651 X:131578903-131578925 CCATTCCTAGTCAAAGAAAGGGG + Intergenic
1198020027 X:132648385-132648407 CCACTGGCATACTGAGAAAGTGG - Intronic
1198127722 X:133662746-133662768 CCATTGCCAAAGAGAGAAAAAGG + Intronic
1198130546 X:133690391-133690413 CCCTTCCCTTACAGAGGAGGAGG + Intronic
1199240714 X:145544810-145544832 CCATTCCAAATCAGAGAAATTGG + Intergenic
1201988325 Y:19993768-19993790 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic