ID: 989168988

View in Genome Browser
Species Human (GRCh38)
Location 5:38456822-38456844
Sequence GAGGAGGGAGTCATCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989168986_989168988 -10 Left 989168986 5:38456809-38456831 CCTCTTACAAAATGAGGAGGGAG 0: 1
1: 0
2: 2
3: 17
4: 198
Right 989168988 5:38456822-38456844 GAGGAGGGAGTCATCCCAGGTGG No data
989168981_989168988 27 Left 989168981 5:38456772-38456794 CCTCTCTCTTGGGCAATGAGGTG 0: 1
1: 0
2: 0
3: 10
4: 144
Right 989168988 5:38456822-38456844 GAGGAGGGAGTCATCCCAGGTGG No data
989168980_989168988 28 Left 989168980 5:38456771-38456793 CCCTCTCTCTTGGGCAATGAGGT 0: 1
1: 0
2: 1
3: 11
4: 203
Right 989168988 5:38456822-38456844 GAGGAGGGAGTCATCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989168988 Original CRISPR GAGGAGGGAGTCATCCCAGG TGG Intronic
No off target data available for this crispr