ID: 989169772

View in Genome Browser
Species Human (GRCh38)
Location 5:38462602-38462624
Sequence TCCTCTCTCTAGTCTAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989169770_989169772 16 Left 989169770 5:38462563-38462585 CCTCTGAGCAGCTTTTTCTGACC 0: 1
1: 1
2: 3
3: 50
4: 357
Right 989169772 5:38462602-38462624 TCCTCTCTCTAGTCTAAGTTAGG 0: 1
1: 0
2: 1
3: 14
4: 106
989169771_989169772 -5 Left 989169771 5:38462584-38462606 CCATCTCTCTAATAACTGTCCTC 0: 1
1: 0
2: 0
3: 14
4: 228
Right 989169772 5:38462602-38462624 TCCTCTCTCTAGTCTAAGTTAGG 0: 1
1: 0
2: 1
3: 14
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989169772 Original CRISPR TCCTCTCTCTAGTCTAAGTT AGG Intronic
900940270 1:5793935-5793957 TTCTCTCTCCAGTGTCAGTTCGG - Intergenic
903092507 1:20934119-20934141 TTCTCTCTCTCTTTTAAGTTAGG - Intronic
903943472 1:26947334-26947356 TCCACTCTCTAGCCAAAGTGGGG - Intergenic
905023270 1:34832688-34832710 TCCTCCCTCCAGGCTAAGTTGGG + Intronic
905415448 1:37800631-37800653 TCATCTGTCTTCTCTAAGTTAGG + Exonic
906445190 1:45890150-45890172 TGCTGTCTGTAGACTAAGTTGGG + Intronic
908418621 1:63937624-63937646 TCCTTTCTCTATTCAACGTTAGG - Intronic
913699454 1:121360582-121360604 TCCTCTCTCTCAGCTAACTTGGG - Intronic
914138091 1:144919454-144919476 TCCTCTCTCTCAGCTAACTTGGG + Intronic
919011424 1:191970122-191970144 TTCTCTCTCTAGAGTAAGTGGGG - Intergenic
920486863 1:206379290-206379312 TCCTCTCTCTCAGCTAACTTGGG - Intronic
923033293 1:230266652-230266674 TCCTCTCTCTCTTCTAATTTAGG - Intronic
1063737960 10:8782792-8782814 TTCTCCCTCTAGTCAATGTTTGG - Intergenic
1068014060 10:51492049-51492071 GCCACTCTCTAATCTAAGTCAGG + Intronic
1068508168 10:57929345-57929367 GCCTCTCTCTACTCTAGCTTTGG + Intergenic
1071076360 10:81758160-81758182 TACTTTCTCTAGTTTAAGATTGG - Intergenic
1073281751 10:102359614-102359636 TCCTCCCTGTAGTATAAGTTAGG - Intronic
1074299633 10:112222044-112222066 TCCTCTCTCTTGTATTAGTTTGG - Intergenic
1074310718 10:112320716-112320738 TTCTCTCCCTAGACTAAGTATGG + Intergenic
1074405756 10:113179069-113179091 TTCTCTCTCTGCTCAAAGTTAGG + Intergenic
1077414115 11:2416584-2416606 TCTTCTCACCAGTCTCAGTTTGG - Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1079213461 11:18484775-18484797 TCCCCTTTCTAATATAAGTTTGG + Intronic
1080243996 11:30159169-30159191 TCCTCTGTCTAGTCTAGCCTTGG - Intergenic
1082272863 11:50191100-50191122 TTCTCTCTCTAGTCTATATCTGG - Intergenic
1086853908 11:91843699-91843721 TCCTCTCCCTTGCCCAAGTTGGG - Intergenic
1092847408 12:12596589-12596611 TCCTCTCTCTCCTCTAGGGTAGG + Intergenic
1093315376 12:17643713-17643735 TCTTATCTCTATTCTATGTTGGG - Intergenic
1095258510 12:40070501-40070523 TCCTTTCTCAAGTCTATTTTAGG + Intronic
1101867447 12:108530912-108530934 TCCACTCACTAGGCTAAGTGAGG + Intronic
1108027796 13:46196730-46196752 GCCTCTCTGTTGTCAAAGTTTGG - Intronic
1117245494 14:53880652-53880674 TCCCCTCTCTAGTCTATATGTGG + Intergenic
1120407775 14:84110277-84110299 TCCTCTCTCTAGTGCATGTTTGG - Intergenic
1121751478 14:96361798-96361820 TCCTCTCCCTAGTTTATGTCAGG + Intronic
1122736139 14:103843414-103843436 TCCTTTCTATAATCTAAATTGGG + Intronic
1127001293 15:54509921-54509943 TTTTCTCTGTAGTCTAACTTGGG + Intronic
1130910455 15:88267030-88267052 TGCTCTCTCTCCTCCAAGTTTGG - Intergenic
1131575365 15:93584804-93584826 TCCTCTCCCTACCCTAAGGTGGG + Intergenic
1133133915 16:3696063-3696085 TGCTCTCTGTAGCCTAAGTGGGG - Intronic
1135554652 16:23425904-23425926 TCCTCTCTCTAGTTAATTTTTGG - Intronic
1138298161 16:55904790-55904812 TCATCTTTCTAGTCTCAGGTCGG + Intronic
1139707228 16:68749620-68749642 TCCTCCCTGTAGTCCAAGGTGGG + Intronic
1140092315 16:71848820-71848842 TCCTTTCTGTAGCCTAATTTGGG - Intronic
1141613943 16:85199675-85199697 TTCTCTCTGAAGTCTAAGTTTGG + Intergenic
1146069870 17:29670227-29670249 ACCTCTCTCTCATCTAAGTCTGG + Intronic
1147672071 17:42182088-42182110 TCCTGTGTCTAGTCTCACTTTGG - Intergenic
1149540805 17:57466642-57466664 TCCCTTCTCTGGTTTAAGTTGGG + Intronic
1151247899 17:72809418-72809440 TCCCATCTCTACTCCAAGTTTGG + Intronic
1151867262 17:76812275-76812297 TCCTCTCTCTATTCTCAGAAGGG + Intergenic
1158927966 18:62289823-62289845 TCCTCTTTCTACTCTCTGTTGGG - Intronic
1160001882 18:75032510-75032532 TCTTCTCTCGACTCTAAGGTAGG + Intronic
1161393855 19:4034568-4034590 TCCTCTCTCTACCCGAAGCTGGG - Intronic
1162723085 19:12673993-12674015 TCTTCTCTCTAGCCCAAGCTGGG - Intronic
1166319206 19:42006078-42006100 TCCTCTCTCTCCTCTACCTTTGG - Intronic
1166674611 19:44732362-44732384 TTCTCTTTCTAGTCTGAGTCAGG - Intergenic
925257863 2:2505604-2505626 TTCTCTCTCCAGCCTTAGTTTGG - Intergenic
930774311 2:55157575-55157597 TCCTCTCACTAGTATAAGCAGGG - Intergenic
931437686 2:62263005-62263027 TCATCTCTTTATTCTAATTTAGG + Intergenic
933061800 2:77747361-77747383 TCCTATCTCCTGTCTAAATTAGG - Intergenic
934899665 2:98148826-98148848 TTCTCTTTCTAGTCTGAGGTTGG + Intronic
934936120 2:98466694-98466716 TCCTCTCTCTCCTGTGAGTTTGG - Intronic
939781079 2:146448697-146448719 TCCTCTCTCTATTTTTAGTGTGG + Intergenic
944906276 2:204265096-204265118 TCCTCTCTCTAGACTCAGAAAGG - Intergenic
946115293 2:217456061-217456083 TACTCTCTCAAGTCTATGTTGGG + Intronic
1170718503 20:18853388-18853410 TCCTCTCTCTCGTCTCCTTTTGG + Intergenic
1176675966 21:9777820-9777842 TCCTCTCCCTTGTCTATGGTGGG - Intergenic
1176989379 21:15476733-15476755 TCCACTCTCTAGTATAAGTGTGG - Intergenic
1177131747 21:17265855-17265877 TCTTCTCTCTAGTCTTTGTTAGG - Intergenic
1178229132 21:30760969-30760991 GCCTTTCTCTAGTCTAAGAAGGG - Intergenic
1178701343 21:34835819-34835841 GCCTCTTTCTAGTCTAGGATTGG - Intronic
1182172010 22:28240572-28240594 TCCTCTCTGGAGACTAAGCTAGG - Intronic
1183792719 22:40086418-40086440 TCCTCTCACTAGTCAAGGATGGG - Intronic
951600224 3:24366312-24366334 ACCCCTTTCTAGTCTAAGATTGG - Intronic
951659952 3:25052137-25052159 TCCTCTGTCCAGTTTAAGTTAGG - Intergenic
954996278 3:54884927-54884949 TGCTCCATTTAGTCTAAGTTGGG - Intronic
956174933 3:66464055-66464077 TTCTTTCTCAAGTCTAAGTTGGG - Intronic
957204539 3:77178876-77178898 TGTTCTCTCTAGTCTTAGTGTGG + Intronic
958127399 3:89374847-89374869 TTTTCTGTCTACTCTAAGTTGGG - Intronic
958556406 3:95683446-95683468 GCCTCTCTTTATTCTAAGTGTGG - Intergenic
958928519 3:100184978-100185000 TCCTTTCTCTTGTCTCATTTGGG + Intergenic
961580691 3:127879566-127879588 TCCTCACCCTTGTCTTAGTTCGG + Intergenic
962358527 3:134715544-134715566 TCCTCTCTCTAGACTGGGTTGGG + Intronic
962364743 3:134771207-134771229 TCCTTTCTCTAGGCTGAGTGGGG + Intronic
964261647 3:154845837-154845859 TTCTCTGGCTAGTCTATGTTGGG - Intergenic
965989958 3:174804673-174804695 TCCTTTCTTTAGTCTAAGTTAGG - Intronic
967206324 3:187125695-187125717 TCCTCGCTCCAGCCAAAGTTAGG - Intronic
967482521 3:189990078-189990100 TTCTCTGTTTAGTCTGAGTTTGG + Intronic
971088780 4:23314759-23314781 TTCTTTCTATAGTCTCAGTTTGG - Intergenic
971183767 4:24354180-24354202 CCCTCTCTCTAGTCACAGCTAGG + Intergenic
972332472 4:38076640-38076662 TCTTCTCTCTGGTCTATTTTTGG - Intronic
974342340 4:60630459-60630481 TGGTCTCACTTGTCTAAGTTTGG + Intergenic
976748573 4:88430725-88430747 TCCTGTCTCTACTCTTATTTGGG - Intronic
978173969 4:105707841-105707863 TGATCTCTCCAGTCTAAATTGGG + Intronic
980713681 4:136603870-136603892 TCAACCCTCTAGTTTAAGTTTGG - Intergenic
981812673 4:148793414-148793436 ACCTCTATCTATTTTAAGTTTGG + Intergenic
987722174 5:21651049-21651071 TCCTCTTCCTAGTACAAGTTAGG + Intergenic
989169772 5:38462602-38462624 TCCTCTCTCTAGTCTAAGTTAGG + Intronic
990453880 5:55964755-55964777 GCCTCTTTCTAGTCAAACTTAGG + Intronic
991245313 5:64503886-64503908 TCCTTTCTCTAGTCTTTGATAGG + Intergenic
998477489 5:142433923-142433945 TCCTCTCCCTAGTTGAGGTTTGG - Intergenic
1000560968 5:162788904-162788926 TCCTCTCACTAGTCAAGGATGGG - Intergenic
1003691062 6:8354215-8354237 TCCTCTCACTACTCAAAGTGAGG + Intergenic
1012230925 6:96760708-96760730 TCCTCTCTCTTGCCTAAAATAGG - Intergenic
1014389672 6:120846186-120846208 TTTTCTGTCTAGTCTAACTTGGG - Intergenic
1020854572 7:13401724-13401746 AACTTTCTCTAGTCTGAGTTTGG - Intergenic
1027833586 7:83213222-83213244 CCCTCTCTTTAGTCAGAGTTTGG + Intergenic
1031128856 7:117807597-117807619 TCTTCTGTGTAGTCTAAGCTTGG + Intronic
1031812895 7:126394175-126394197 GCCTCTCTTCAGTGTAAGTTTGG + Intergenic
1039243321 8:35580801-35580823 TGCTCTCTTTAGTCAAACTTTGG - Intronic
1053207661 9:36200591-36200613 TTATCTCTCTAGTCCAATTTAGG + Intronic
1053433930 9:38062699-38062721 TCATTTTTCTAGTCTCAGTTGGG - Intronic
1053475898 9:38381892-38381914 GCCTCTCTCTAGGCTAAGAAGGG - Intergenic
1059211860 9:112520513-112520535 TCCTATCTATAGTTTAAGTTTGG - Intronic
1059374411 9:113871124-113871146 TCCATTCTCTATTCTGAGTTTGG + Intergenic
1060375556 9:123112913-123112935 TTCTGTCTCCAATCTAAGTTCGG - Intronic
1187158138 X:16740100-16740122 TCCTCTTCCTAGTCCAAGATTGG + Intronic
1194255922 X:91633385-91633407 TTTTCTGTCTAGTCTAACTTGGG + Intergenic
1196322134 X:114353897-114353919 ATCTCTTTCTAGTCTAAGTTGGG + Intergenic
1198016669 X:132618615-132618637 TGGTCTCTCTGGTCTGAGTTGGG - Intergenic
1200574651 Y:4872655-4872677 TTTTCTGTCTAGTCTAACTTGGG + Intergenic
1200769022 Y:7106491-7106513 TCCTCTCTCAGGTGTAAGCTGGG - Intergenic
1201020115 Y:9647546-9647568 TTCTCTCTCTAATCTAGGCTAGG - Intergenic