ID: 989171934

View in Genome Browser
Species Human (GRCh38)
Location 5:38479947-38479969
Sequence GAATCCTGATTTTAACTGCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989171934_989171936 20 Left 989171934 5:38479947-38479969 CCTAGCAGTTAAAATCAGGATTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 989171936 5:38479990-38480012 GATTTTGTCACTTGTCACTCTGG 0: 1
1: 0
2: 0
3: 27
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989171934 Original CRISPR GAATCCTGATTTTAACTGCT AGG (reversed) Exonic
905624506 1:39479032-39479054 GAATCCACATTTTAAGTTCTGGG + Intronic
907754197 1:57294203-57294225 CAAGCCTGAATTTAACTGATAGG - Intronic
909525045 1:76613414-76613436 GAATTCTGACTTTATCTGGTAGG - Intronic
910525729 1:88175823-88175845 GGATGATGATTTTAACTTCTTGG + Intergenic
912304260 1:108549269-108549291 AGATCCTGCTTTTAAATGCTGGG - Intergenic
914866345 1:151433024-151433046 TAGTCATTATTTTAACTGCTAGG + Intronic
916653564 1:166852591-166852613 GAACTCTGATTTAAACAGCTGGG + Exonic
916837081 1:168556852-168556874 AGTTCCTGATTTTGACTGCTTGG + Intergenic
918336166 1:183515810-183515832 GTATAATGGTTTTAACTGCTGGG + Intronic
919151526 1:193706589-193706611 GAATACTGATTAAAAGTGCTAGG - Intergenic
1069490436 10:68856257-68856279 AAATGCTGAATTTAACTGTTAGG - Intronic
1074116709 10:110461608-110461630 TAATGGTTATTTTAACTGCTGGG + Intergenic
1074341177 10:112631616-112631638 GAATATTGATTTTAAGTTCTAGG + Intronic
1075018043 10:118925426-118925448 AAATCCTGATTTTCAGTGATGGG - Intergenic
1081662626 11:44897205-44897227 GAACCCTCATTTCCACTGCTGGG + Intronic
1088985096 11:114898942-114898964 GAACTCAAATTTTAACTGCTGGG - Intergenic
1089379722 11:118019408-118019430 GACTCCTCAATTTGACTGCTGGG - Intergenic
1089795240 11:120975103-120975125 GAACCCTGATTTTCACAGCCTGG - Intronic
1091655443 12:2342851-2342873 GCATCCTCAGTTTCACTGCTGGG - Intronic
1092466362 12:8736274-8736296 GACTTTTCATTTTAACTGCTTGG - Intronic
1096140677 12:49240162-49240184 GAATCCTGAGTTCAACTGCCAGG - Intronic
1096687520 12:53298591-53298613 GAATCCTGATTATAACAGAGGGG - Intronic
1097484326 12:60175501-60175523 GAATCCTGTTTTTAAATCATTGG + Intergenic
1097660792 12:62428804-62428826 AAATCCTGATTTTAATTTTTTGG + Intergenic
1098461560 12:70737825-70737847 GAATACAGATTTTAACTTCCAGG + Intronic
1099757769 12:86876750-86876772 GAATGCAGATTCTGACTGCTAGG + Intergenic
1100092671 12:90990518-90990540 GAAACCTGATTTTATCTCCTGGG + Intronic
1100945076 12:99773706-99773728 AAATCTGGATTGTAACTGCTGGG - Intronic
1102421351 12:112805461-112805483 GAATCCTCTTTTTCACTGCCTGG + Intronic
1102800006 12:115723853-115723875 GAATCCTCATTTCATCTTCTCGG - Intergenic
1102879847 12:116475944-116475966 GAATCCTCATGTTGACTGCGAGG - Intergenic
1103282155 12:119767682-119767704 GAATGATGATTTTAACTGACTGG + Intronic
1104205516 12:126634788-126634810 GAATCCTGATTCTAGCTTCTGGG - Intergenic
1109769410 13:66951540-66951562 GAATGATTATTTTAAATGCTGGG + Intronic
1111243029 13:85500882-85500904 AAATCCTCAGTTTTACTGCTGGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112953839 13:105035256-105035278 GAATCCTGCTCGTCACTGCTGGG + Intergenic
1116437202 14:44909143-44909165 TGATGCTGATTTTAAATGCTAGG - Intergenic
1119202778 14:72770407-72770429 GGATCCTGATTTAAACTACAGGG + Intronic
1120203779 14:81566437-81566459 GAGGCCTGAGTTTAACAGCTTGG - Intergenic
1121029735 14:90647792-90647814 TAATTCTGTGTTTAACTGCTGGG + Intronic
1125376192 15:39032290-39032312 GTATACTGATTTTTGCTGCTAGG - Intergenic
1126450460 15:48802972-48802994 TAGTCCTGATTTTCACTGCCTGG - Intronic
1129816242 15:78557020-78557042 GAGTCTTGACTTTAACTCCTGGG + Intergenic
1131057171 15:89382164-89382186 GAGTCCTGATTTTAACTTGTGGG - Intergenic
1134342538 16:13358313-13358335 AAATCCTGGTTTTAAAAGCTTGG + Intergenic
1134407138 16:13970444-13970466 GAATTCAGATTCTAACCGCTGGG + Intergenic
1139188705 16:64836915-64836937 GAACCCTGATTTTCACAGATAGG + Intergenic
1139813121 16:69640077-69640099 GAATGCTTATTTTATATGCTGGG + Intronic
1144287881 17:13796138-13796160 GAGTAATGATTTTAAGTGCTGGG - Intergenic
1146991386 17:37276070-37276092 GAATCCTGACTGTAACACCTTGG + Intronic
1147441738 17:40451744-40451766 GTATTCTGGTTTTGACTGCTTGG + Intronic
1148251487 17:46084786-46084808 GAAACCTCATTTTAAAGGCTAGG - Intronic
1148667424 17:49384975-49384997 GGATCCTGATTAGAACTCCTCGG + Intronic
1150547503 17:66175626-66175648 GATTCCTAATTTTAATTCCTGGG - Intronic
1150973077 17:70052621-70052643 GAATACTGACATTAAATGCTGGG - Intergenic
1153467474 18:5405201-5405223 GAATTCTTATTTTTACTGCAAGG + Intronic
1155726433 18:29090883-29090905 GAAGCCTGATATTAGCTGGTAGG + Intergenic
1156182856 18:34625993-34626015 GAATCCGGATTTGATCTGATAGG + Intronic
1156567644 18:38213706-38213728 AGATCCTGATTTAAATTGCTTGG + Intergenic
1156949735 18:42880744-42880766 GAATGGTGATTTTAACAGCAAGG + Intronic
1161147487 19:2687674-2687696 GCATCATGATTTAAACTTCTTGG - Intronic
1164927334 19:32140526-32140548 GGATGCTGAGTTTATCTGCTGGG + Intergenic
930633829 2:53783480-53783502 GAATCCTATTTTTCACTTCTGGG - Intronic
933143083 2:78817550-78817572 AAATCCTGACTTCAACTGTTAGG + Intergenic
935238297 2:101156367-101156389 GAATCATGCTTTTAACTTTTTGG + Intronic
935697337 2:105781526-105781548 CAAACCAGATCTTAACTGCTAGG - Intronic
940147725 2:150564647-150564669 ATTTCCTGATTTGAACTGCTAGG - Intergenic
942738972 2:179151076-179151098 GAATCCTGATTCTAGTTGCTAGG - Intronic
942761316 2:179401067-179401089 TAAACCTGAGTTTAATTGCTGGG + Intergenic
943762232 2:191622426-191622448 GAATCCTAATGTTAAATGCCTGG + Intergenic
947451027 2:230209164-230209186 GAATTCTGAAATTAACTGTTGGG + Intronic
948325643 2:237118171-237118193 GAATCATGATTTTTTCTCCTGGG + Intergenic
1169966754 20:11226259-11226281 GATTCCTGGTTTTAAATCCTAGG - Intergenic
1170918680 20:20654725-20654747 GCATACTGATTTTAATTCCTTGG + Intronic
1174679877 20:52395993-52396015 GAATCCTGACAATAAGTGCTAGG - Intergenic
1175389974 20:58620878-58620900 GCAGCCTGACTTTAACTCCTGGG + Intergenic
1176923753 21:14721571-14721593 GCAAACTTATTTTAACTGCTAGG - Intergenic
1179138309 21:38699848-38699870 GAATCCTGCTTGTATCAGCTGGG + Intergenic
1179624636 21:42641920-42641942 GAATCCAGCTCTTACCTGCTGGG - Intergenic
1181374684 22:22447536-22447558 GAAGCTTGAAATTAACTGCTGGG + Intergenic
952111372 3:30127700-30127722 GTTTCCTGATTTTAAATGGTTGG - Intergenic
953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG + Intronic
955759440 3:62262966-62262988 GCATCCTGCTTCTGACTGCTTGG - Intronic
956871795 3:73425521-73425543 GAATCCTGTTTTTAACTCACAGG - Intronic
959512468 3:107229603-107229625 AAAGCCTGATTTTACCTACTAGG + Intergenic
960921691 3:122753390-122753412 GAATCTAGATTTTATCTGGTAGG + Intronic
961218290 3:125178946-125178968 GAATCATGATTTTATCTTTTGGG + Intronic
962582022 3:136806669-136806691 GAATCATGATTTTAACCTTTAGG + Intergenic
965945896 3:174241173-174241195 TTATACTCATTTTAACTGCTAGG + Intronic
965986962 3:174765969-174765991 GCAACCTTATTTTCACTGCTAGG + Intronic
973221827 4:47735306-47735328 GAATACTTATTTTAAATTCTAGG + Intronic
973779281 4:54273010-54273032 GACTCCTCATCTTAACTTCTAGG + Intronic
975143208 4:70938986-70939008 GAATCCAAATTTGAACTGCAAGG - Intronic
985788424 5:1911935-1911957 GTAACCTCATTTTAACAGCTGGG + Intergenic
989171934 5:38479947-38479969 GAATCCTGATTTTAACTGCTAGG - Exonic
995904229 5:117104208-117104230 GGATTTTGATTTTAACTGCAGGG + Intergenic
996756206 5:126937980-126938002 GAATCCTGGTATTTAATGCTTGG + Intronic
999769711 5:154766203-154766225 GAATTCTGATTTTAGCTGGAAGG + Intronic
999867175 5:155713440-155713462 GAAACTTGACTTTATCTGCTTGG + Intergenic
1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG + Intergenic
1007513583 6:42393623-42393645 GAATGCAGATTTTAATAGCTAGG - Intronic
1010480166 6:76342030-76342052 TATTCCTGATTTGAAATGCTTGG - Intergenic
1013832061 6:114285045-114285067 GAATGCTGAATCTTACTGCTAGG + Intronic
1016256000 6:142106148-142106170 GAGTCCTGAATTTACATGCTAGG + Intergenic
1016467346 6:144338896-144338918 GAAGCCTGACTTGAACAGCTGGG + Intronic
1023531027 7:41154645-41154667 CAATTCTGATTTTTACTGATAGG + Intergenic
1028353508 7:89878876-89878898 GAATCCAGCTTCCAACTGCTGGG + Intergenic
1033243842 7:139702466-139702488 GTATCCTCATTCTAAGTGCTGGG - Intronic
1035623770 8:1055831-1055853 GAATCCTGATTCTTACTTCAAGG + Intergenic
1037511724 8:19589989-19590011 GAGGTCTGATTTTAACTTCTTGG - Intronic
1038912084 8:31976207-31976229 GAGTTCTGGATTTAACTGCTTGG + Intronic
1043057892 8:75463451-75463473 GACTCCTGATTTGAAAGGCTAGG + Intronic
1043602849 8:81962070-81962092 GAATTCTTATTTTAAGTTCTGGG + Intergenic
1044060929 8:87634133-87634155 GAACCCTGCTTGTAACTACTTGG + Intergenic
1044374586 8:91454695-91454717 GAATCCTGGTTTCACCAGCTGGG - Intergenic
1044473827 8:92603385-92603407 GACTGCTGATTTTAACAGCCCGG - Intergenic
1045547902 8:103144186-103144208 GAATTCTGAATTTCACTGCAGGG + Intronic
1049123637 8:140765143-140765165 GTATAAGGATTTTAACTGCTGGG + Intronic
1050323531 9:4478237-4478259 GGATCATGATTGTAACTGATTGG + Intergenic
1052081260 9:24208722-24208744 TAATTCTGATTTTAACCACTAGG + Intergenic
1052439514 9:28476874-28476896 GATTCCAGTTTTTAACTGATTGG - Intronic
1055876573 9:80950258-80950280 GTATCCTGATTTTGCCTGGTAGG + Intergenic
1056562320 9:87742137-87742159 GGTTCCTGATTTTAACCCCTTGG - Intergenic
1062084064 9:134639609-134639631 GAATCCTGATTGGTACTGCCGGG + Intergenic
1186876036 X:13818854-13818876 TAATTCTCATTTGAACTGCTGGG - Intronic
1191795426 X:65016759-65016781 GAAACCTGATTTGAAGTACTTGG + Intronic
1192928728 X:75782749-75782771 AACTCCCGATTTTAAGTGCTGGG - Intergenic
1193459066 X:81768532-81768554 TTCTCCTGATTTTAACTCCTAGG - Intergenic
1194639064 X:96380880-96380902 CAATCCTGATTTAAATTTCTGGG - Intergenic
1197403509 X:126023073-126023095 GGAACCTGATATTAAGTGCTGGG + Intergenic
1197501005 X:127242599-127242621 GCTTCCTGATTTTTACTCCTTGG - Intergenic
1199251376 X:145666052-145666074 GGATCCTAATTTTAATTCCTAGG + Intergenic