ID: 989174206

View in Genome Browser
Species Human (GRCh38)
Location 5:38505344-38505366
Sequence CTGTATCTTGCATGTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989174203_989174206 -1 Left 989174203 5:38505322-38505344 CCTTTGTAGTGACAGGGCAGTTC 0: 1
1: 0
2: 3
3: 640
4: 1615
Right 989174206 5:38505344-38505366 CTGTATCTTGCATGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989174206 Original CRISPR CTGTATCTTGCATGTGGTGG TGG Intronic
No off target data available for this crispr