ID: 989175590

View in Genome Browser
Species Human (GRCh38)
Location 5:38521965-38521987
Sequence ATGTACTACGAGAGGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989175590_989175594 -2 Left 989175590 5:38521965-38521987 CCTCAGGCCCTCTCGTAGTACAT 0: 1
1: 0
2: 1
3: 6
4: 76
Right 989175594 5:38521986-38522008 ATGTAGACACTAGCTGTGGTAGG No data
989175590_989175593 -6 Left 989175590 5:38521965-38521987 CCTCAGGCCCTCTCGTAGTACAT 0: 1
1: 0
2: 1
3: 6
4: 76
Right 989175593 5:38521982-38522004 GTACATGTAGACACTAGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 81
989175590_989175595 2 Left 989175590 5:38521965-38521987 CCTCAGGCCCTCTCGTAGTACAT 0: 1
1: 0
2: 1
3: 6
4: 76
Right 989175595 5:38521990-38522012 AGACACTAGCTGTGGTAGGCAGG 0: 1
1: 1
2: 8
3: 37
4: 164
989175590_989175596 9 Left 989175590 5:38521965-38521987 CCTCAGGCCCTCTCGTAGTACAT 0: 1
1: 0
2: 1
3: 6
4: 76
Right 989175596 5:38521997-38522019 AGCTGTGGTAGGCAGGCATGCGG 0: 1
1: 1
2: 2
3: 36
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989175590 Original CRISPR ATGTACTACGAGAGGGCCTG AGG (reversed) Intronic
906246721 1:44281249-44281271 AGGTACTGTGTGAGGGCCTGGGG - Intronic
909546577 1:76854687-76854709 ATGTGCTATGAGAGGCCATGTGG - Intergenic
912210707 1:107554003-107554025 ATGAACTAACAGAGGTCCTGAGG + Intergenic
912444863 1:109727554-109727576 ATATACATCCAGAGGGCCTGAGG - Intronic
915056262 1:153133943-153133965 ATGGACTACCAGGGAGCCTGAGG + Intergenic
917602646 1:176593502-176593524 ATGTACTAGAAGAGGTACTGAGG + Intronic
924932038 1:248740435-248740457 ATGTACTAGAAAAAGGCCTGGGG + Intronic
1071059641 10:81554556-81554578 AGGTACTAGGAGATGGACTGGGG - Intergenic
1073645133 10:105293859-105293881 ATGCACCACTAGAGGACCTGAGG + Intergenic
1074235605 10:111581671-111581693 ATGTCCCAGGAGAGGGGCTGTGG + Intergenic
1077844974 11:6013821-6013843 ATGTGCTACCTGGGGGCCTGAGG + Intergenic
1079857613 11:25625898-25625920 ATGTACTACAATATGGCCAGTGG + Intergenic
1081908172 11:46682286-46682308 CTGTGCTAGGGGAGGGCCTGTGG - Intronic
1082258221 11:50055762-50055784 AGGTATTACCAGAGGGCCAGGGG - Intergenic
1083689551 11:64398882-64398904 ATGGACCAAGACAGGGCCTGAGG + Intergenic
1084450560 11:69234347-69234369 ATGTACTCCGAGATGACTTGGGG + Intergenic
1086974001 11:93112814-93112836 ATGAGCTCTGAGAGGGCCTGGGG - Intergenic
1087757806 11:102073481-102073503 ATGTACCACTGGAGGACCTGAGG - Intronic
1090641285 11:128730999-128731021 AAGTGCTTCGAGAGGTCCTGAGG + Intronic
1095565714 12:43621328-43621350 ATGTACCACCACGGGGCCTGAGG - Intergenic
1097003321 12:55896943-55896965 ATGTACTATGTCAGGGACTGAGG + Intergenic
1099974970 12:89537014-89537036 ATGTGCTATGAGAGCACCTGTGG - Intergenic
1102325911 12:111983479-111983501 ATGCACTACGCGGGGGTCTGAGG + Intronic
1103026805 12:117580751-117580773 AGGGACTACCAGAGAGCCTGGGG + Intronic
1104121756 12:125806473-125806495 AAGAACTAAGAGAGGGCCGGGGG - Intergenic
1108308831 13:49165836-49165858 ATGTACCACCTGTGGGCCTGGGG - Intronic
1109155649 13:58906248-58906270 ATATACCACCAGTGGGCCTGGGG - Intergenic
1111176784 13:84606124-84606146 ATGTACCACCAGGGGGCTTGAGG - Intergenic
1113536997 13:111076117-111076139 ATGTACCACATGAAGGCCTGGGG - Intergenic
1114899012 14:27032927-27032949 ATGTACTAGGATGGGGCCTCTGG + Intergenic
1115873560 14:37835050-37835072 ATGTGCTACCTCAGGGCCTGAGG - Intronic
1117866260 14:60152689-60152711 ATGTACTACAACAGACCCTGGGG - Intronic
1118732088 14:68675482-68675504 AAGTGCTAAGAGAAGGCCTGGGG + Intronic
1121310107 14:92931345-92931367 ATGGGCTCCGGGAGGGCCTGGGG - Exonic
1121908000 14:97765037-97765059 ATGGATTAGGAGAGGGCCAGGGG + Intergenic
1126661648 15:51038824-51038846 ATGCACCACGAGGGGGCCTGAGG - Intergenic
1130693179 15:86104216-86104238 ATGCACTACCAGAGGGCCAGAGG - Intergenic
1137050710 16:35711327-35711349 CTGTACTATTAGATGGCCTGGGG + Intergenic
1152559047 17:81068735-81068757 AAGTCCTGCGGGAGGGCCTGGGG + Intronic
1157820812 18:50767239-50767261 ATGTGCTACTAGGGAGCCTGGGG + Intergenic
1160409673 18:78667228-78667250 CTGTCTTATGAGAGGGCCTGGGG - Intergenic
1161509209 19:4661396-4661418 AGGTACTACGACGGGGGCTGGGG + Intronic
1164803870 19:31100872-31100894 ATGAACTACGAAAAGGCCAGGGG - Intergenic
1167469881 19:49669784-49669806 ATGTACTACCAGAGGAGGTGTGG + Intronic
936818077 2:116484706-116484728 ATGTACCACCAGGGAGCCTGAGG + Intergenic
937465665 2:122131217-122131239 ATGTACTACCAGGGGGCCTGAGG - Intergenic
938822691 2:134975479-134975501 GTGTACCACTGGAGGGCCTGAGG - Intronic
944617357 2:201475220-201475242 AAGTACTACGTGAGCACCTGGGG - Intronic
1179924524 21:44527038-44527060 ATGTAGAACGAGATGGCATGTGG + Intronic
1181776239 22:25161799-25161821 ATGCACTTCGGGATGGCCTGTGG + Intronic
951317237 3:21203050-21203072 ATGCACTCCTAGAGGGCCAGGGG - Intergenic
954227495 3:49191694-49191716 AGGTACAACCAGAGGGCCAGGGG + Intronic
954795385 3:53158849-53158871 ATGTACTCAGAGAGGGTCAGAGG - Intronic
957290097 3:78268530-78268552 ATGTACTACCAAAGAGCTTGAGG - Intergenic
975124269 4:70764332-70764354 ATGTACTGGGAGAGGTCCTGAGG + Intronic
977564678 4:98568924-98568946 ATGTAGTGAGAAAGGGCCTGAGG + Intronic
977719590 4:100224053-100224075 ATGCACCGCCAGAGGGCCTGAGG - Intergenic
983625522 4:169798097-169798119 TTCTACTGCCAGAGGGCCTGGGG + Intergenic
988077104 5:26367219-26367241 AGGTAATACCAGGGGGCCTGAGG - Intergenic
989175590 5:38521965-38521987 ATGTACTACGAGAGGGCCTGAGG - Intronic
990628010 5:57635993-57636015 AGGTAATACGATAGGGCCTCAGG - Intergenic
995369423 5:111402175-111402197 ATCTGCCACGAGAGGGCATGAGG - Intronic
998752647 5:145340093-145340115 ATGCACTACTAAGGGGCCTGAGG + Intergenic
998811640 5:145972480-145972502 AAGTACTACGAGTGGGCAAGTGG - Intronic
1003248271 6:4402274-4402296 ATGGACTTGGAGAGGGCCCGTGG - Intergenic
1018535874 6:164818479-164818501 CTGTACTACTAATGGGCCTGAGG + Intergenic
1020911552 7:14138166-14138188 ATGTAATATGAGATGGCCTGAGG + Intergenic
1021537519 7:21722316-21722338 ATGAACCATGAGAGGCCCTGAGG - Intronic
1026621768 7:71955845-71955867 ATGTACTCTAAGAGGGCTTGAGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028940898 7:96521119-96521141 ATTTTCTTCGAGGGGGCCTGAGG + Intronic
1037274224 8:17160019-17160041 ATGCACTATGAGAGGGAATGAGG + Intronic
1040459771 8:47636033-47636055 ATTTACTACTTGAGGGCTTGTGG + Intronic
1044738395 8:95301721-95301743 ATGTTCCACGGGACGGCCTGAGG + Intergenic
1049245726 8:141561305-141561327 TTTTACTGCGGGAGGGCCTGGGG - Intergenic
1050054556 9:1638099-1638121 TTTTACTAGGAGACGGCCTGTGG + Intergenic
1050988885 9:12120878-12120900 AGGTACTACTCTAGGGCCTGGGG - Intergenic
1051201761 9:14633963-14633985 ATGTACCACCAGGGGACCTGAGG + Intronic
1056724034 9:89096575-89096597 ATGTACAAAAAGAGGGCTTGGGG - Intronic
1189246334 X:39566300-39566322 AAGAACTGAGAGAGGGCCTGGGG - Intergenic
1190924954 X:54894634-54894656 ATGCACTACGGAGGGGCCTGAGG + Intergenic
1190994616 X:55594023-55594045 ATGTAATACGGGAAGGCCTGTGG + Intergenic
1192713412 X:73615700-73615722 ACACACTACCAGAGGGCCTGAGG - Intronic
1196986766 X:121282184-121282206 ATGTACTACCAAGGGGCCTGAGG - Intergenic