ID: 989176357

View in Genome Browser
Species Human (GRCh38)
Location 5:38530869-38530891
Sequence GAGGCCAATTTTCAAATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989176357 Original CRISPR GAGGCCAATTTTCAAATGAT GGG Intronic
903047071 1:20572696-20572718 CAGGCCACTTTTTAAAGGATAGG + Intergenic
907646572 1:56250519-56250541 GAGGCCATTTTTCAGATGAAAGG - Intergenic
907723195 1:56993298-56993320 GAGTCTAATTTTAAAATAATTGG - Intergenic
908371099 1:63478319-63478341 CAGGACAATTTGAAAATGATTGG + Intronic
908652372 1:66349667-66349689 GACATCAAGTTTCAAATGATTGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909124338 1:71646621-71646643 GAAGCCATTTTTCAAATGTGTGG - Intronic
909778118 1:79509700-79509722 GAGGCCATTTTTAAAAGGCTAGG - Intergenic
910035735 1:82785386-82785408 GAGGCCAAAATTGAAGTGATCGG + Intergenic
910156126 1:84222449-84222471 GAAAACAATTTTTAAATGATAGG - Intronic
910807500 1:91203525-91203547 GAGGCCAATGTTCGATGGATTGG - Intergenic
911158263 1:94657114-94657136 GAGGCAAGTTTTCAAAGGCTGGG - Intergenic
917685905 1:177415949-177415971 GAGGCAAATGTTAAAATAATAGG - Intergenic
919363243 1:196622191-196622213 GATGCTAATTTTCAAATAATTGG + Intergenic
920009102 1:202854915-202854937 GAGGCCCATTATCAGATGATGGG - Intergenic
923373924 1:233341061-233341083 GAGGCCAATTGTTAAAGAATGGG + Intronic
1063124461 10:3126619-3126641 GAGGCCAGTTTTCCCATGACTGG - Intronic
1064194241 10:13232645-13232667 CAGGACTGTTTTCAAATGATGGG - Intronic
1064873521 10:19966759-19966781 GAGGCCTGTTCTCAAATTATGGG - Intronic
1065167861 10:22999728-22999750 GAGCCCAAGTTTCACATGCTTGG + Intronic
1067104096 10:43353748-43353770 GAGGCCAAATAACAAATGGTTGG + Intergenic
1068838983 10:61589134-61589156 GAGGCCAAGTTTGAAATCAAAGG + Intergenic
1071710743 10:88046611-88046633 GAGGCTAATATTTATATGATAGG + Intergenic
1074064657 10:110003046-110003068 ATGGCCAAGTTTCAAATGAATGG + Intronic
1074392158 10:113067340-113067362 AAAGTCAATTTTCAAATGCTTGG + Intronic
1078944432 11:16047612-16047634 GAGGGCAATTTTTTGATGATAGG + Intronic
1079954373 11:26844250-26844272 GATGCCAACTTTCAAATTATTGG + Intergenic
1081395409 11:42580755-42580777 GAGGACAATATTAAAAAGATAGG - Intergenic
1085846019 11:80066029-80066051 CAAGCCAATTTACAAATTATTGG - Intergenic
1086428645 11:86713771-86713793 GAAGCTAATCTTCAAATGAGAGG + Intergenic
1087109210 11:94445035-94445057 GAGGCCAATTTTTAGACCATAGG + Intronic
1089375432 11:117990647-117990669 TAGGCCAATTTTGAAGTAATTGG - Intronic
1090101534 11:123802613-123802635 GAAGCCAATCTGGAAATGATGGG - Intergenic
1091024474 11:132129723-132129745 GAGCCCCATTTTGAAATGACTGG - Intronic
1092818288 12:12330167-12330189 GAAGCCATTTTTCAAATGGAAGG + Exonic
1099005852 12:77233901-77233923 GAGGCCAATTCTTAGATAATGGG + Intergenic
1099026749 12:77473980-77474002 GATGCCCATTATCAAATGAATGG + Intergenic
1099871128 12:88350620-88350642 TTGGCCAAGTTTAAAATGATAGG - Intergenic
1101598781 12:106190255-106190277 GAGGCCTACTTTAAAATGTTAGG - Intergenic
1101781004 12:107835792-107835814 AAGGCCAATATTCAAATGATTGG + Intergenic
1104098361 12:125582508-125582530 GAGGCCAATTATGGAATGTTTGG + Intronic
1105209246 13:18248054-18248076 GAGGCCAATTCTCCAAGGCTGGG - Intergenic
1115493160 14:33978410-33978432 GAAGCCAATTTTGAGTTGATGGG - Intronic
1115944629 14:38645567-38645589 GATGCCAATTTTGAAAGGGTGGG + Intergenic
1116562054 14:46392221-46392243 AAGGCCAGGATTCAAATGATGGG + Intergenic
1120014293 14:79452574-79452596 GAAGGCAATTTTCAAATGTAGGG + Intronic
1120211597 14:81639176-81639198 CATGCCAATTTTTTAATGATAGG + Intergenic
1126155118 15:45558825-45558847 CTGGCCAATTTTTAAATGTTTGG + Intergenic
1127828596 15:62728718-62728740 TAACCCAATTTTCAAATAATGGG - Intronic
1129630561 15:77255213-77255235 CAGGCCAATTTTTAAATTTTGGG - Intronic
1130211673 15:81928964-81928986 GAGGTGAATTTTTAAATGAATGG + Intergenic
1138277423 16:55745972-55745994 GATGCCAGTTTCCCAATGATTGG - Intergenic
1138283397 16:55789753-55789775 GATGCCAGTTTCCCAATGATTGG - Intergenic
1138285604 16:55807234-55807256 GATGCCAGTTTCCCAATGATTGG + Intronic
1140887717 16:79259289-79259311 GAGGCCAGTTTTCCAAGCATGGG - Intergenic
1140985560 16:80155186-80155208 GTGGCCATTTTTCAGATCATGGG + Intergenic
1148487485 17:48000136-48000158 GAGGCCAGTGTTCAAATGCAGGG + Intergenic
1156361944 18:36391304-36391326 GAGGCCATTTTTCTTAGGATTGG + Intronic
1159063188 18:63539026-63539048 CTGGCCAATATTTAAATGATTGG + Intergenic
1159867688 18:73725581-73725603 GAGGGAAATTTTCATATGTTCGG - Intergenic
1162178623 19:8850728-8850750 GAGGCCACTTTTCACAAGAATGG - Intronic
1164874303 19:31672463-31672485 CAGGCTAATTTTTAAATTATTGG - Intergenic
924996130 2:363607-363629 GTGGCCAGTTTTCAAAATATGGG - Intergenic
926552619 2:14318196-14318218 GTGGTCAATATTCAACTGATTGG - Intergenic
927033459 2:19147370-19147392 GTGGCCATTTTTCCAATGAGTGG - Intergenic
931853972 2:66282199-66282221 GAGGCCAATTGTGAAATGCCTGG - Intergenic
932491218 2:72122715-72122737 GATGCCAATATACAAATGTTGGG - Intergenic
937258492 2:120570858-120570880 CAGGCCATGTTTCAAATGCTCGG - Intergenic
937654158 2:124356117-124356139 GAAGACAGTTTTCAAATCATGGG - Intronic
940831446 2:158470821-158470843 GATGCTAATTTTAAAAAGATTGG + Intronic
940831799 2:158474802-158474824 GATGCTAATTTTAAAAAGATTGG - Intronic
941771054 2:169346462-169346484 CAAGTCAATTGTCAAATGATTGG - Intronic
942944966 2:181662011-181662033 GAGGTCAATTTTGGAATGGTTGG - Intronic
947016343 2:225624470-225624492 GAGGCCAATTTTTACATGGGTGG + Intronic
948104420 2:235401653-235401675 AAAGCCAAGATTCAAATGATGGG - Intergenic
948743346 2:240064294-240064316 GAGGCCAACTTTTAAAAAATAGG - Intergenic
1171290416 20:23979767-23979789 GAGGCCAATTCTCCAAGGCTGGG - Intergenic
1174916786 20:54662003-54662025 GAGGTCAATTATTAAATGACTGG - Intergenic
1175008947 20:55715234-55715256 GAAGCCTACTTTCAAAAGATAGG - Intergenic
1178236817 21:30852687-30852709 GAGGCAAATTCTGAAAAGATGGG + Intergenic
1179393575 21:41016349-41016371 TAAGCCAATTTGCAAATCATAGG - Intergenic
1184709027 22:46237111-46237133 GAGCCAAATTTTCTAAAGATGGG - Exonic
951961917 3:28335363-28335385 GAAGCCTCTTTTCAAAAGATGGG - Intronic
953917750 3:46931442-46931464 GAGGCCAGTTTGCCAGTGATGGG - Intronic
958641231 3:96808591-96808613 TATGCTAATTGTCAAATGATTGG + Intergenic
959297918 3:104560963-104560985 AAGGCCAATTTTAATATGTTTGG + Intergenic
961054011 3:123771357-123771379 GAGTCCCATTTCCAAATGTTAGG + Intronic
967779566 3:193420225-193420247 GTGGCCATTTTACAGATGATGGG - Intronic
970327042 4:14936598-14936620 GAAGACAATTTTTAAATCATTGG + Intergenic
970772787 4:19635618-19635640 GAGGAAATTTCTCAAATGATGGG + Intergenic
971201367 4:24512133-24512155 GAGGCCTGTTTTTAAATGAGTGG - Intergenic
971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG + Intergenic
971748744 4:30619098-30619120 GATTCCAATTTTCAATTGACAGG + Intergenic
973195096 4:47430507-47430529 GAGTCAAATGTCCAAATGATGGG + Intergenic
974219730 4:58950968-58950990 GAGTACAATTTTAAAAGGATGGG + Intergenic
976118046 4:81749516-81749538 GATGCTAATTTTAAGATGATGGG + Intronic
979346847 4:119597808-119597830 GAGGCCAATTTTCAACTGAGAGG + Intronic
979372481 4:119906259-119906281 GAAGACAATTTTCCAAGGATGGG + Intergenic
980216731 4:129861739-129861761 GAGGCACATATTCAAATGAAGGG - Intergenic
981432336 4:144676120-144676142 GAGGGCAATCTTTAAATGATGGG + Intronic
982611265 4:157576575-157576597 GTCGCCAATATTCAAATGTTAGG - Intergenic
987227855 5:15862377-15862399 CAGGGCAATTTACAAATGAAAGG - Intronic
989176357 5:38530869-38530891 GAGGCCAATTTTCAAATGATGGG + Intronic
993315597 5:86402182-86402204 GAAGCCAATTTTCAGAATATGGG - Intergenic
993548696 5:89246477-89246499 GAAGCCAACATTCAAAAGATTGG - Intergenic
993573107 5:89567389-89567411 GAGGCCATTTGCCAAATGTTGGG + Intergenic
994952006 5:106475439-106475461 GAAGACAATTTTCCACTGATGGG - Intergenic
996892003 5:128432060-128432082 GAGGTGAAGTTTTAAATGATTGG - Intronic
1000599101 5:163250759-163250781 GAGTCCAATGTTCACATGTTTGG - Intergenic
1003399210 6:5778035-5778057 GAGGGAAATTTTCAGGTGATGGG + Intergenic
1005772444 6:29087620-29087642 CAGGCCAAATTTAAAATAATTGG - Intergenic
1007659372 6:43473908-43473930 GATGACAATTTTCATATGGTTGG - Intergenic
1009517024 6:64633669-64633691 GAAGCCAACTTTCCAATGATGGG - Intronic
1010578385 6:77562441-77562463 GAGGCCAATTTTGATATAAAAGG + Intergenic
1011224201 6:85088974-85088996 TAGGCCATTTTACAAATGAAGGG - Intergenic
1012802065 6:103843148-103843170 AAGGCAAATTTTCATATTATTGG + Intergenic
1016222866 6:141697119-141697141 AAAGCCAATATTCAAATGTTAGG + Intergenic
1016983520 6:149876088-149876110 GATACCAATTTGCAAATGAGAGG - Intergenic
1021460252 7:20879024-20879046 GTGGCCAATCTCCAAATGTTAGG - Intergenic
1021670173 7:23027902-23027924 GATGCCAAGATTCAAATTATAGG - Intergenic
1024201821 7:47116185-47116207 GAGAACAATTGTCATATGATTGG + Intergenic
1027248184 7:76381099-76381121 AAGGGCAATTTTCAAAGGCTAGG + Intergenic
1030090614 7:105854560-105854582 GAGGTTAGTTTTCATATGATGGG - Intronic
1030569292 7:111202053-111202075 GAAGCTACTTTTCAAAAGATGGG - Intronic
1032006063 7:128302931-128302953 AAGGCTAATTTTCAAATTTTGGG + Exonic
1034931064 7:155164535-155164557 GAGGGCAAGTCTCAAATAATCGG + Intergenic
1036227696 8:6973681-6973703 GAGGGCAATTTTCACAGTATTGG + Intergenic
1036230149 8:6992840-6992862 GAGGGCAATTTTCACAGTATTGG + Intergenic
1036232601 8:7011943-7011965 GAGGGCAATTTTCACAGTATTGG + Intronic
1043782434 8:84352836-84352858 GAGCTCAATGTTCAAATGCTAGG - Intronic
1045163520 8:99576653-99576675 GTGGACAATGTTCAAATGCTTGG - Intronic
1045557174 8:103225766-103225788 GAGGGCAATTCTCAAAAGAAGGG + Intronic
1046849424 8:118955525-118955547 AAGGCCAATTTTCAAAGAAAGGG - Intergenic
1050227803 9:3480545-3480567 CAGGCCAATGTTCAGATGACTGG + Intronic
1055997907 9:82181431-82181453 GAGGCCAATAGTAAACTGATGGG - Intergenic
1057046099 9:91887174-91887196 GATGGCAACTTTCAAATAATTGG - Intronic
1057105807 9:92414738-92414760 GAGGACAATATTTAAATGACAGG - Exonic
1057900747 9:98946011-98946033 GAGGGCCATTTGCAACTGATGGG + Intronic
1058611329 9:106779413-106779435 GAGGCCAATTTTCTAATGAGAGG - Intergenic
1059010217 9:110449856-110449878 GTTGCCTATTTTAAAATGATAGG + Intronic
1186649617 X:11544488-11544510 GAAGCCAATTTCAAAATGACAGG - Intronic
1187974336 X:24690272-24690294 GTGGCCAATATGCAAATGAGAGG - Intergenic
1189105974 X:38235632-38235654 GAGCCCAATTGACAAGTGATGGG - Intronic
1191995179 X:67087882-67087904 GTGTCCAATTTTCAAATTTTGGG - Intergenic
1193717346 X:84948543-84948565 GATGCCAAGTTTCAAATGCCTGG + Intergenic
1193827687 X:86246179-86246201 GATGCCAATGTTCATATGATTGG - Intronic
1195461000 X:105124082-105124104 TAAGCCAATTTACAAATGACAGG - Intronic
1196059862 X:111396314-111396336 TAGGCCAATTTTCAATTGGAAGG - Intronic
1199032152 X:143013353-143013375 GAGCTCAATTTTCAACTGCTGGG - Intergenic
1199136798 X:144263131-144263153 GAGCCCATATTTCAAATGCTAGG + Intergenic