ID: 989177385

View in Genome Browser
Species Human (GRCh38)
Location 5:38541843-38541865
Sequence GAAAATGAACAAATACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1572
Summary {0: 1, 1: 5, 2: 26, 3: 208, 4: 1332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989177383_989177385 15 Left 989177383 5:38541805-38541827 CCAAAATGAAATGATAATGTTGA 0: 1
1: 0
2: 3
3: 56
4: 441
Right 989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG 0: 1
1: 5
2: 26
3: 208
4: 1332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989177385 Original CRISPR GAAAATGAACAAATACAGAT GGG Intronic
901217855 1:7564866-7564888 GACAATGAACAAAAACAGTGGGG + Intronic
901262023 1:7879110-7879132 GAAAATCAACAAAGAAACATTGG + Intergenic
901617913 1:10556398-10556420 GAAAAAGAACACGTGCAGATAGG - Intronic
901767236 1:11510795-11510817 GAAAAGGAACTAATACAGATGGG - Intronic
902120013 1:14156377-14156399 GAAAATCAACAAAGAAACATTGG - Intergenic
902125916 1:14211201-14211223 ATAAATAAACAAATAGAGATAGG - Intergenic
902441966 1:16436392-16436414 AAAAAAAAAAAAATACAGATAGG + Intronic
902494595 1:16861460-16861482 GAAAATGAAGAAATAAAGGTTGG - Intronic
902746027 1:18475069-18475091 TGAAATGAACAAATAAAGACAGG - Intergenic
902830034 1:19006575-19006597 ATGAATGAACAAATAAAGATAGG + Intergenic
903146673 1:21377211-21377233 GAAAATGAACTAATAAAGATGGG + Intergenic
903373535 1:22852026-22852048 AAACATGAACAACTCCAGATAGG - Intronic
903456355 1:23489850-23489872 GAAAGTGAAGGAATACAGAATGG + Intergenic
904218476 1:28943991-28944013 GAAAATCTACATATACACATTGG + Intronic
904275027 1:29376958-29376980 GAAAATCAACAAAGAAATATTGG - Intergenic
904730398 1:32586490-32586512 GATAATAAACAAATACATAAAGG + Intronic
904858468 1:33517583-33517605 GAGAAGGAAAAAATAAAGATTGG + Intronic
905114568 1:35626270-35626292 GAAGACGAAAAAAGACAGATGGG - Intronic
905162614 1:36050016-36050038 GAAAATCAACAAAGAAACATTGG + Intronic
905621589 1:39452917-39452939 GAAAAGGAACAAAACCAGAGTGG + Intronic
906020580 1:42625892-42625914 GAAAATCAACAAAGAAACATTGG - Intronic
906352491 1:45075249-45075271 GAAAATCAACAAAGAAACATTGG - Intronic
906463947 1:46059286-46059308 GAAAATGGACTAATACAAATGGG + Intronic
906785497 1:48611953-48611975 GAAAAGGAACATAAACAGCTAGG + Intronic
906880069 1:49579854-49579876 GAAAATTAACAAAGACACACTGG - Intronic
907721066 1:56972708-56972730 GAAAATGGACTAATACAGATAGG + Intergenic
908211434 1:61904577-61904599 GAGAATGGACTAATACAGAAGGG - Intronic
908358574 1:63345875-63345897 GAAAATGCACAAATAGATACTGG - Intergenic
908374326 1:63518765-63518787 ACAAAGGAACAAAAACAGATGGG - Intronic
908424707 1:63995236-63995258 GATAATGAAAAAATACATACTGG + Intronic
908427724 1:64024176-64024198 GAAAATGGACTAATACAAATGGG + Intronic
908500372 1:64737674-64737696 GGAAATGAACAAAGAAAGAGTGG - Intergenic
908538206 1:65098223-65098245 GAAAAGGAACAAAGAAACATTGG - Intergenic
908751165 1:67424652-67424674 GAAAAGCTACAAATACATATGGG + Intronic
908991202 1:70092206-70092228 GAAAATGTTGAAAAACAGATTGG + Intronic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909133975 1:71773795-71773817 GAAACTGAAAGAAGACAGATTGG - Intronic
909510911 1:76451170-76451192 GAGAATGGACTAATACAGATGGG - Intronic
909511140 1:76453819-76453841 GAAAATGAACAAAGAAACAATGG - Intronic
909588431 1:77318066-77318088 GAGAATGAACTAATACAATTGGG - Intronic
909751522 1:79166685-79166707 GAGAATGGACTAATATAGATGGG + Intergenic
909848576 1:80431288-80431310 GAAAATCAACAAAGAAACATTGG - Intergenic
909866870 1:80685242-80685264 GAAAATGAACTAATACAGTGGGG - Intergenic
910105887 1:83630620-83630642 GAAAATTGACTAATACAGATAGG + Intergenic
910230515 1:84982306-84982328 TAAAATAAAAAAATAGAGATGGG + Intronic
910473493 1:87580266-87580288 GAAAATCAACAAATAGAGGGTGG + Intergenic
910557201 1:88547853-88547875 TAAAATGAACAAATAATTATTGG - Intergenic
910598217 1:89002890-89002912 GAAAATCAACAAATAAACAATGG - Intergenic
910801051 1:91146595-91146617 GAAAATCATCAAATAAACATTGG - Intergenic
911115095 1:94238044-94238066 AAAAAAAAAAAAATACAGATAGG - Intronic
911292089 1:96069468-96069490 GAAAATCAACAAAGAAACATTGG - Intergenic
911343595 1:96670385-96670407 GAAAATCAACAAAGAAACATCGG - Intergenic
911370017 1:96985560-96985582 GAAAATGAACTAATATAGTTAGG - Intergenic
911386955 1:97188262-97188284 AAAAATGATGAAATACATATTGG - Intronic
911483380 1:98473856-98473878 GAGAATGAACTAATACACTTGGG + Intergenic
911709736 1:101056576-101056598 GAAAATTATCAAATACACTTTGG - Intergenic
911752875 1:101518319-101518341 GAAAATCAACAAATAAACATTGG - Intergenic
912020767 1:105106915-105106937 AGAAATGAACAAAGACAGCTTGG + Intergenic
912079447 1:105916569-105916591 GAAAATAAACAAAAAGAAATAGG - Intergenic
912089432 1:106053037-106053059 AAAAATGAACAAACAAACATTGG + Intergenic
912108359 1:106309120-106309142 GAAAATCAACAAAGAAACATTGG + Intergenic
912148498 1:106825030-106825052 GAAAATTCACAAATACTGAAAGG - Intergenic
912315809 1:108666872-108666894 CAAAATGGACTAATACAGAGAGG + Intergenic
913242231 1:116839029-116839051 GAAAAAGGACTAATACAGAGAGG + Intergenic
913316441 1:117557880-117557902 GAAAATGAACTAATACAGAGGGG - Intergenic
913590411 1:120319478-120319500 GAAAAAGAACAAAAACTGAGAGG - Intergenic
913617775 1:120578885-120578907 GAAAAAGAACAAAAACTGAGAGG + Intergenic
913967577 1:143389793-143389815 GTAAATGAATAAAATCAGATAGG + Intergenic
913985054 1:143557459-143557481 GAACTTGAAGAAATACAGAGGGG + Intergenic
914061950 1:144215383-144215405 GTAAATGAATAAAATCAGATAGG + Intergenic
914117200 1:144750971-144750993 GTAAATGAATAAAATCAGATAGG - Intergenic
914335667 1:146713077-146713099 GAAAGCTAACATATACAGATTGG - Intergenic
914572496 1:148932087-148932109 GAAAAAGAACAAAAACTGAGAGG - Intronic
914600345 1:149198175-149198197 GAAAAAGAACAAAAACTGAGAGG + Intergenic
914902327 1:151717295-151717317 GAAAAAGAAAAAATGCAGAGAGG + Intronic
914989721 1:152488173-152488195 GAAAATCAACAAAGAAACATTGG - Intergenic
915337042 1:155150350-155150372 GAAAATCAACAAAGAAACATCGG + Intergenic
915867821 1:159524037-159524059 GAAAATCAACAAAGAAACATTGG - Intergenic
916022483 1:160805636-160805658 GAAAATCAACAAAGAAACATTGG - Intronic
916287471 1:163125322-163125344 ACAAATGACCAAATACAAATGGG - Intronic
916341322 1:163739047-163739069 GAAAATGGACTAGTACAGCTGGG - Intergenic
916409393 1:164530438-164530460 GAAAAGAAACAAATACAGTAAGG + Intergenic
916616129 1:166442320-166442342 GAAAATCAACAAAGAAACATTGG - Intergenic
916887973 1:169088566-169088588 GAAAATGCTCAAACACAGACAGG + Intergenic
916993946 1:170275495-170275517 TAAAATTAAGAAATAAAGATGGG - Intergenic
917334132 1:173911099-173911121 GAAAAAGAACAAAAAGAAATAGG + Intronic
917775041 1:178324487-178324509 GAAAATGGAAAAAAACAAATGGG - Intronic
917809744 1:178646693-178646715 GAAAGGGAAGAAATACAGTTTGG + Intergenic
917983936 1:180295581-180295603 CAAAATGAACAAATGCTGTTGGG - Intronic
918073350 1:181150161-181150183 GAAAATGGACTAAGACAAATGGG - Intergenic
918261800 1:182803015-182803037 TAAAACCAGCAAATACAGATGGG + Intronic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918429554 1:184444586-184444608 GAAAATGGACTAATACAACTGGG + Intronic
918440846 1:184565893-184565915 GAAAATTTACATACACAGATTGG - Intronic
918997157 1:191776517-191776539 GGAAATCAACAAAAACACATAGG + Intergenic
919043966 1:192427705-192427727 GAAAATTAACAAAGAAATATTGG + Intergenic
919374236 1:196772516-196772538 GAAAATCAACAAAAAGACATTGG - Intergenic
919532382 1:198739679-198739701 GAAAATCAACAAAGAAACATTGG + Intronic
919584236 1:199416274-199416296 GAAAATGGACTAATACAGGGAGG + Intergenic
919821399 1:201475007-201475029 AAAAATCAAACAATACAGATTGG - Intergenic
920407218 1:205725028-205725050 GGAAATTAACAAAGAGAGATAGG - Intronic
920731814 1:208494333-208494355 GAAAATTAACAAAGACATTTTGG - Intergenic
920734401 1:208517718-208517740 GAAAATGAACTAATACAGATTGG - Intergenic
921035186 1:211370998-211371020 GAAAATAAATATATAAAGATAGG + Intronic
921275925 1:213520134-213520156 GAAAATGGACTAATACACAGAGG - Intergenic
921457363 1:215388657-215388679 GAGAATGAACTAATACAGCTGGG - Intergenic
921464933 1:215476549-215476571 GAGCATGAACTAATACAGGTAGG - Intergenic
921621762 1:217333288-217333310 GAAAGAGAACAAATGCAGCTGGG + Intergenic
921634906 1:217480766-217480788 GAAAATGTACATATACATAATGG + Intronic
921712843 1:218389978-218390000 GCAAATGAAGATATAGAGATGGG - Intronic
921750867 1:218792300-218792322 GAAATTAAAGAAATTCAGATTGG - Intergenic
922111590 1:222562785-222562807 GAAAATGATCAAACACAGGTAGG + Intronic
922319515 1:224473746-224473768 GAAAATCAACAAAGAAACATTGG + Intronic
922345981 1:224696683-224696705 AAGAATGAATAAATTCAGATTGG - Intronic
922388285 1:225111157-225111179 GAAAATCAACAAAGAAACATTGG - Intronic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
922583672 1:226717907-226717929 GAAAATGAACAATTCCACAGAGG - Intronic
922644429 1:227272451-227272473 TAAAAAGAAAAAATACAAATGGG + Intronic
922877933 1:228955452-228955474 GAAAATGGACTAAGACAGAAAGG + Intergenic
923707822 1:236359510-236359532 AAAAATGGACTAATACAGCTGGG - Intronic
923802616 1:237225286-237225308 GAAAACGGACGAATACAGGTGGG - Intronic
923887167 1:238171030-238171052 GAATATCAACAAAGACACATTGG - Intergenic
923956844 1:239031897-239031919 GAAAATGAAAAAAGACAAACTGG + Intergenic
924036371 1:239942789-239942811 AAAAAGGAACTAATACAGAAAGG - Intergenic
924246217 1:242087605-242087627 AAAAATAAATAAATACAGAAAGG - Exonic
924331967 1:242948756-242948778 GAAAATTAACAAATATATTTGGG + Intergenic
924830051 1:247584208-247584230 GAAAAGGAAGAAATACAAATAGG - Intergenic
924832177 1:247608326-247608348 GAAAATCAACAAACAAACATTGG + Intergenic
1063303294 10:4873375-4873397 GAAAATGGACTAATACAGTCAGG + Intergenic
1063905264 10:10774739-10774761 GAGAAGGAACTAATACAAATAGG + Intergenic
1063909174 10:10812072-10812094 GAAAATGGACTAATATAGGTGGG - Intergenic
1064136634 10:12756629-12756651 GAGACTGAACAAACACAGCTGGG + Intronic
1064446831 10:15401988-15402010 GAAAATCAACAAAGAAACATTGG + Intergenic
1064468248 10:15607558-15607580 GAAAATGAAAACAGACAGATGGG + Intronic
1064634654 10:17351540-17351562 GAAAATGAATAAATACCCAAAGG + Intronic
1064696609 10:17973618-17973640 GAAAAGGAACAAATATACAATGG - Intronic
1064791569 10:18962412-18962434 GAAAATGGACTAATACAGGAGGG - Intergenic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1065011973 10:21429005-21429027 GAAAAAAAAAAAATACAGTTGGG - Intergenic
1065399488 10:25281261-25281283 TCAAATGAAAAAATACAGTTAGG + Intronic
1065674018 10:28155228-28155250 GAAAATACCCAAATACAGATGGG + Intronic
1065698536 10:28402693-28402715 GAGAATGAACTAATACAGTAGGG - Intergenic
1065751232 10:28889869-28889891 GAAAATGGACTAATACACACAGG - Intergenic
1065880237 10:30031429-30031451 AAAAAAAAAAAAATACAGATGGG - Intronic
1065880288 10:30031741-30031763 AAAAAAAAAAAAATACAGATGGG - Intronic
1065996389 10:31063423-31063445 TAAAATAAAAAAATACATATAGG + Intergenic
1066030494 10:31418283-31418305 GAATATGAACAAATACCCAGTGG + Intronic
1066086694 10:31978623-31978645 AAAAATAAAAAAATAAAGATAGG - Intergenic
1066191993 10:33064515-33064537 GAAAATGAACTAATACACAAGGG + Intergenic
1066236109 10:33486254-33486276 AAAAATGAACAAATACAGGAAGG - Intergenic
1066241852 10:33544785-33544807 AAAAATTAACAAAGACAAATGGG + Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1066526997 10:36291982-36292004 GAAAATCAACAAAGAAATATTGG - Intergenic
1066551779 10:36566696-36566718 CAAAATAAATAAATACAGAATGG - Intergenic
1066565654 10:36719159-36719181 GAAAATGAACAAAGACAAACGGG + Intergenic
1066610836 10:37247192-37247214 GAAAAAGAACAAAAAGTGATTGG + Intronic
1066622525 10:37373392-37373414 GAAAATAAACAAACAAATATTGG - Intronic
1066672561 10:37856201-37856223 GAAAATGGAAAAATAGAAATAGG - Intronic
1067428998 10:46230028-46230050 AAAAAAGAACAAATAAAGATGGG + Intergenic
1068125153 10:52830495-52830517 GAAAATCAACAAAGAAACATTGG + Intergenic
1068145174 10:53060218-53060240 GGAAAAGAACGAATATAGATAGG - Intergenic
1068229691 10:54156274-54156296 GAAAACAGACTAATACAGATGGG - Intronic
1068261073 10:54582751-54582773 GAAAATTAAAAAATATAGCTGGG + Intronic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1068278252 10:54831683-54831705 GGAAATGAAAATATACTGATTGG - Intronic
1068666208 10:59678518-59678540 GAAAAAGAAAAAAAAAAGATTGG - Intronic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1069335541 10:67345373-67345395 GAAAATCAACAAAGAAACATTGG - Intronic
1070210650 10:74316709-74316731 GAAAATGAACTAATACCGGGAGG + Intronic
1070318785 10:75338783-75338805 GAGAAGGAACACACACAGATTGG + Intergenic
1070514310 10:77189516-77189538 AAAAATGATGAAGTACAGATGGG + Intronic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1071205231 10:83267614-83267636 GAAAATCAACAAAGAAACATTGG - Intergenic
1071262406 10:83932701-83932723 AAAAATGAACAAAAACAAAAAGG + Intergenic
1071667101 10:87569114-87569136 GAAAATTAACAAACAAACATTGG + Intergenic
1072042621 10:91623526-91623548 GAAAAGGAACATAAACAAATGGG + Intergenic
1072227550 10:93384336-93384358 GAAAATGAAATAATATAAATTGG + Intronic
1072332854 10:94370579-94370601 GACAATGAATAAATAAAGAATGG - Intergenic
1072344150 10:94486850-94486872 GAAAATCAACAAAGAAACATTGG - Intronic
1072582429 10:96750848-96750870 GAAAATTGACAAATACACAGAGG + Intergenic
1072769048 10:98121840-98121862 GAAAATTAACAAATAAACAATGG - Intergenic
1072785776 10:98280419-98280441 GATAATGACCAAACACAGACAGG - Intergenic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1073645553 10:105298612-105298634 GAAAATTAACAAAGAAACATAGG + Intergenic
1073667313 10:105548057-105548079 GAGAATGGACTAATACAGAGAGG + Intergenic
1073678292 10:105674549-105674571 GAAAGTAAAGAAATACAGAACGG + Intergenic
1073726742 10:106240773-106240795 GAAAATTAACAAATGCACATAGG - Intergenic
1073833269 10:107411308-107411330 GAAAATGGACTAACACAGACTGG + Intergenic
1073946605 10:108757927-108757949 CAAAATGAACAAGGACAGTTTGG - Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074637836 10:115341548-115341570 GAAAATCAACAAAGAAACATGGG - Intronic
1075063475 10:119273093-119273115 GAATATGAACAAAACCAGACCGG + Intronic
1075081945 10:119390194-119390216 GAAAACGGACTAATACAGACGGG - Intronic
1075122136 10:119672119-119672141 GAAAATTGAAAATTACAGATAGG + Intronic
1075152257 10:119944434-119944456 GAAAATGGACTAATACAGTCAGG + Exonic
1075232748 10:120696872-120696894 GAAAATTAACAAAAAAACATTGG - Intergenic
1075302939 10:121341569-121341591 CAAAACGATCAAATACAGAAGGG + Intergenic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1076153398 10:128183342-128183364 GAAAAAGAACATATAGTGATAGG - Intergenic
1076275406 10:129194524-129194546 GAAAATGGACTAATACATAGAGG - Intergenic
1076689917 10:132217910-132217932 GAAAATAGACTAATACAGATGGG + Intronic
1076925845 10:133486169-133486191 GAAAATCAACAAAGAAACATTGG - Intergenic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077202296 11:1316568-1316590 GAAAATTAACAAAGAAACATTGG - Intergenic
1077703646 11:4463649-4463671 GACTATAAACAAAAACAGATTGG + Intergenic
1077859529 11:6163175-6163197 GAAAATCAACAAAGAAATATTGG + Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078231335 11:9445611-9445633 GAAATTGGACAAATACTCATAGG - Exonic
1078304616 11:10172141-10172163 GAAAAGAAACTAATAAAGATCGG - Intronic
1078781296 11:14441628-14441650 GAAAATTGACAAATACACAGAGG + Intergenic
1078959362 11:16247404-16247426 GAGAATGGACTAATACAGAAAGG - Intronic
1078963496 11:16307838-16307860 GAAAATGAGTAAATACAAATAGG - Intronic
1079125746 11:17717808-17717830 CTGAATGAACAAATACAGGTGGG + Intergenic
1079512100 11:21223079-21223101 GAACATCAACAAAAAAAGATTGG - Intronic
1079578725 11:22034882-22034904 GAAAATGAACAATTATAGAATGG - Intergenic
1079745596 11:24124992-24125014 GAAAGTGAAGGAATACATATGGG - Intergenic
1079760773 11:24327439-24327461 TAAAATGAATAAAAACATATAGG - Intergenic
1079857739 11:25627857-25627879 GAGCCTGAACAAATACAGACCGG - Intergenic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1080097028 11:28420320-28420342 GAAAATCAACAAAGAAACATTGG + Intergenic
1080227735 11:29978543-29978565 GAAAATGGACTAATACAGTTGGG + Intergenic
1080367977 11:31599535-31599557 GAGAATGAACTAATACAGCCAGG - Intronic
1080715831 11:34798734-34798756 GAGAATGGACTAATACAGCTAGG + Intergenic
1080787194 11:35486281-35486303 AAAACTGAACCAACACAGATCGG + Intronic
1080824809 11:35838938-35838960 GAAAATGGACTAATACAGATGGG - Intergenic
1080934543 11:36848726-36848748 AAAAATGATCAAATACACATAGG - Intergenic
1080948478 11:37001658-37001680 GAAAATACAAAAATATAGATGGG - Intergenic
1081031740 11:38093131-38093153 TAAAATGGAAAAATATAGATGGG + Intergenic
1082043626 11:47707288-47707310 GAAAATGGACTAACACAGCTGGG - Intronic
1082189618 11:49226861-49226883 GACAATAAACATGTACAGATAGG - Intergenic
1082217539 11:49591599-49591621 GAAAAAGAACAAATACTGGCAGG - Intergenic
1082268052 11:50141130-50141152 AAAAATCAAGAAATACAGAAAGG + Intergenic
1083106329 11:60361709-60361731 ACAAATGAAGAAACACAGATGGG + Intronic
1083283214 11:61640400-61640422 GAAAGTAAACAAATAAAGAATGG - Intergenic
1083512464 11:63223997-63224019 GAAAATCAACAAAGAAACATTGG - Intronic
1083528158 11:63391359-63391381 GAAAATCAACAAAGAAACATTGG - Intronic
1084720895 11:70904994-70905016 GAAAATGGACTAATACAGTGGGG + Intronic
1084903106 11:72324901-72324923 GCAAATGAAAAAATATAGATAGG + Intronic
1085169913 11:74440871-74440893 GAGAATGAACTAATACGTATGGG + Intergenic
1085229514 11:74952941-74952963 GAAAACGGGCAAATACAAATTGG - Intronic
1085610354 11:77942392-77942414 GAAAATGAGGCAGTACAGATAGG + Intronic
1085617868 11:78015348-78015370 GAAAACAGACTAATACAGATGGG + Intergenic
1085646752 11:78228941-78228963 TAAAATGAACAAATCCAGATGGG - Intronic
1085799878 11:79579629-79579651 GAAAATGGACTAATACACATGGG - Intergenic
1086069019 11:82778866-82778888 GAAAATCAACAAAGAAACATTGG + Intergenic
1086524362 11:87707936-87707958 GAAAATCAACAAAGAAACATTGG - Intergenic
1086676906 11:89619644-89619666 GACAATAAACATGTACAGATAGG + Intergenic
1086828502 11:91529585-91529607 GAAAATCAACAAAGAAACATTGG + Intergenic
1086886324 11:92210115-92210137 CAAAGGGAACAAATACAGAGAGG + Intergenic
1086952046 11:92900533-92900555 AACAATGTACAAATACACATAGG + Intergenic
1087031654 11:93711991-93712013 GAAAATCAACAAAGAAACATTGG - Intronic
1087054047 11:93915662-93915684 GAAAATCAACAAAGACACATTGG - Intergenic
1087418929 11:97896250-97896272 GAAAATGAAAATATGCAAATAGG + Intergenic
1087776176 11:102258952-102258974 AAAAATAAATAAATACAGATTGG - Intergenic
1087823702 11:102741224-102741246 GAAAATTAACAAAGAAACATTGG - Intergenic
1087853099 11:103056276-103056298 GAAAATGAACTGAGAGAGATTGG - Intergenic
1088180233 11:107102000-107102022 GAAAATGAAAAGACACAGACTGG + Intergenic
1088552637 11:111028915-111028937 AAAAAAAAAAAAATACAGATTGG + Intergenic
1088706556 11:112469099-112469121 GAAAATAAACAGATAAACATAGG - Intergenic
1088944227 11:114492844-114492866 GAAAATCAACAAAGAAACATTGG - Intergenic
1089732607 11:120528535-120528557 GAAAACAGACTAATACAGATGGG - Intronic
1090924810 11:131240085-131240107 GAAAATGGACTAATAGAAATGGG + Intergenic
1091529587 12:1340983-1341005 CCAAAGGAATAAATACAGATTGG + Intronic
1091630468 12:2156471-2156493 AAAAATGAACAAATAAACACCGG - Intronic
1091852585 12:3712262-3712284 AAGAATGACCTAATACAGATAGG - Intronic
1092082134 12:5724954-5724976 GAACATGAACAAGTAGAGATGGG - Intronic
1092507381 12:9117567-9117589 GAAACAGAAGAAACACAGATTGG + Intergenic
1092671240 12:10863435-10863457 GAAAATTAAGAAATAAACATTGG + Intronic
1092768187 12:11871853-11871875 GAAAATGAAAAAATAAAACTGGG + Intronic
1093060458 12:14597267-14597289 GAAAATTAACAAAGACATCTAGG - Intergenic
1093186335 12:16023379-16023401 TAACATGAACAAAAACAAATGGG - Intronic
1093291519 12:17330146-17330168 GAAAATCACAAAATATAGATGGG + Intergenic
1093324601 12:17758987-17759009 GAAAACGAACTAATACAGGAAGG - Intergenic
1093337480 12:17923845-17923867 GAAAATTAACAAAGTAAGATTGG + Intergenic
1093338106 12:17934586-17934608 GAGACTGAACAAATACATTTGGG + Intergenic
1093382518 12:18510264-18510286 GAAAATTAAAAAATGAAGATAGG - Intronic
1093419466 12:18958209-18958231 GAAAATGTACACATACACAATGG - Intergenic
1093581407 12:20787660-20787682 GAAAATCAACAAAGAAATATTGG - Intergenic
1093642113 12:21540228-21540250 AAACATGAAGAAATACATATAGG + Intronic
1093646614 12:21592737-21592759 GAAAATTAACAAAGAAACATTGG + Intronic
1093956437 12:25224911-25224933 GGAAATGAATACATAAAGATAGG - Intronic
1093999085 12:25675055-25675077 GAAAATGTGGAAATACAGATGGG + Intergenic
1094025240 12:25955070-25955092 GCAAATGGACCAGTACAGATGGG - Intergenic
1094236889 12:28178159-28178181 GAAAATGGACTAATACACTTGGG + Intronic
1094271082 12:28615858-28615880 GAAAATCAACAAAGAAACATTGG + Intergenic
1094271853 12:28625908-28625930 GAAAATGAACTAATACACTCCGG + Intergenic
1094353177 12:29549071-29549093 AAAAATGAACATACAAAGATTGG + Intronic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1094528728 12:31252018-31252040 GAAAATTGACAAATACACAGAGG - Intergenic
1094554793 12:31487889-31487911 GAAAACAAACAAAAACAGCTGGG + Intronic
1094660365 12:32464517-32464539 GAAAAAGGACAAATGCACATAGG + Intronic
1094741878 12:33298937-33298959 GAAAATCAACAAAGAAACATTGG + Intergenic
1095174554 12:39076318-39076340 TAAAATATACAAATACAGCTGGG - Intergenic
1095201837 12:39393752-39393774 GAAAGGGAACTAATACAGGTTGG + Intronic
1095557188 12:43522035-43522057 GAGAACGAACTAATACAGCTGGG - Intronic
1095571739 12:43690856-43690878 GAATATTAACAAAGACAGGTTGG + Intergenic
1095613914 12:44165824-44165846 GAAAATCAACAAAGAAACATTGG + Intronic
1096355945 12:50941145-50941167 AAAAATGAAAAAATTCAGCTGGG - Intergenic
1096370143 12:51062721-51062743 AAAAAAGAACAAAAACTGATTGG + Exonic
1096566522 12:52486634-52486656 GAAATAGAACAAATTCAGAAAGG - Intergenic
1096574414 12:52543751-52543773 GAAAATTAACACAGACATATAGG + Intergenic
1096822397 12:54246924-54246946 TAAAATGAAAAGATACAGTTAGG - Intronic
1096892249 12:54783521-54783543 GAAAATCAACAAAGAAACATTGG - Intergenic
1097139439 12:56887548-56887570 GAGAATGGACTAATACAGACTGG + Intergenic
1097256036 12:57675199-57675221 GAAAATTGACAAATACAGGGAGG + Intergenic
1097517410 12:60622333-60622355 GAAAATTAACAAGTACATACAGG + Intergenic
1097619094 12:61918517-61918539 GAAAATGTACACATACACAATGG - Intronic
1097646788 12:62244884-62244906 GAAAATAAACAAAGAGAAATAGG - Intronic
1097894128 12:64807373-64807395 GAGAATGGACTAATACAGAGAGG + Intronic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1098144799 12:67487506-67487528 GAGAATGGACTAATACAGCTGGG - Intergenic
1098256182 12:68618056-68618078 GAACAAGAACTAATACAGCTGGG - Intronic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1098430363 12:70412719-70412741 GAAAATGTGCATATAAAGATGGG + Intronic
1098536346 12:71597632-71597654 TAAAATGAACCAATACACCTGGG + Intergenic
1098752705 12:74315993-74316015 CAAAATGAACAGTTACAGACTGG - Intergenic
1098900845 12:76110576-76110598 GAAAATGAAAAAGTACCTATAGG + Intergenic
1098959368 12:76723188-76723210 GAAAATCAACAAATAAACATAGG + Intergenic
1099039404 12:77632279-77632301 GAAAACGGGCTAATACAGATTGG - Intergenic
1099229958 12:80012010-80012032 GAAAATCAACAAAGAAACATTGG - Intergenic
1099290920 12:80775539-80775561 GAAAATCAACAAAGAAACATTGG - Intergenic
1099403928 12:82236379-82236401 GAAAATCAACAAAGAAACATTGG - Intronic
1099414222 12:82367731-82367753 GGAAATGAAGAACTACTGATGGG - Intronic
1099621025 12:85003040-85003062 GAAAATCAACCAATATAGATGGG + Intergenic
1099654909 12:85478152-85478174 GAAAACGAACTAATACAACTTGG - Intergenic
1099860086 12:88215430-88215452 GAAAATCAACAAAGAAACATTGG + Intergenic
1100025183 12:90119509-90119531 GAAAATAAACAAAGAAACATTGG - Intergenic
1100285134 12:93158069-93158091 GAAAATGAACTAATATAGTAGGG - Intergenic
1100946654 12:99791376-99791398 GAAAATCAACAGATAAACATTGG + Intronic
1101349220 12:103912907-103912929 GAGAATGAATAAAAACAAATGGG - Intergenic
1101465871 12:104948920-104948942 ATAAATGAACAAATACGGCTGGG + Intronic
1101607846 12:106262038-106262060 GAAAATTAACAAAGAAACATTGG + Intronic
1101626315 12:106445750-106445772 GAAACTGTAAAAATACAGAGAGG + Intronic
1101932221 12:109023933-109023955 GAACATCAAAAAATACTGATTGG - Intronic
1102528830 12:113531420-113531442 GAAAATGGACTAATACACATGGG + Intergenic
1102979406 12:117229526-117229548 AGAAATGAACTAATACATATGGG + Intronic
1103850852 12:123932259-123932281 GAAAAACAAAAGATACAGATAGG - Intronic
1104025288 12:125021529-125021551 GGAAACCAGCAAATACAGATAGG - Intronic
1104210793 12:126686249-126686271 GAAGAAAAACAAATACAAATTGG + Intergenic
1104304832 12:127600219-127600241 GAAAATGGACTAATACAAAAAGG + Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104489509 12:129181829-129181851 GAAAATGGACAAATAAAGGATGG - Intronic
1104498312 12:129261565-129261587 GAAAATGGACTAATACAGACTGG + Intronic
1104572098 12:129934459-129934481 GAAAATGGACTAATACAAATGGG + Intergenic
1105063506 12:133175870-133175892 GAAAATCAACAAAGAAACATTGG + Intronic
1105688463 13:22810558-22810580 AAAAGTTAACAAATAAAGATAGG + Intergenic
1105869525 13:24491881-24491903 CAAAAAGAACTATTACAGATGGG + Intronic
1105898369 13:24737086-24737108 GAAAATGAACAAAGGATGATGGG - Intergenic
1105977272 13:25482952-25482974 GAAAACGGACTAATACAGAAGGG + Intronic
1106048727 13:26169805-26169827 GCCAATTAGCAAATACAGATAGG + Intronic
1106067637 13:26371358-26371380 GAAGATGAGGAAATACAGTTAGG - Intronic
1106615727 13:31325767-31325789 GAAGATGAACAAACACAGTTTGG - Intronic
1106774535 13:32996107-32996129 AAAGATTAACAAATACAAATAGG + Intergenic
1106910353 13:34456543-34456565 GAAAATGAACTAATACAATTAGG + Intergenic
1107083644 13:36402525-36402547 GAAAATCAACAAAGAAACATCGG - Intergenic
1107183041 13:37484615-37484637 GAAAACGGACTCATACAGATGGG - Intergenic
1107223761 13:38020763-38020785 GAAAATTAACAAAGAAATATTGG - Intergenic
1107311156 13:39079875-39079897 GAAAAGGAAAAAGAACAGATAGG + Intergenic
1107586312 13:41851743-41851765 GAAAATGGATTAATACAGACGGG + Intronic
1107696251 13:43003028-43003050 TAAGATGAACAAGAACAGATTGG + Intergenic
1107909340 13:45090529-45090551 GAAAGTGAAGAAATAAAGAATGG + Intergenic
1108133686 13:47332327-47332349 GAGAATGAACTAATACGGAATGG - Intergenic
1108174709 13:47780306-47780328 GAAAAAGAAAAAATACAAAAGGG + Intergenic
1108404711 13:50088707-50088729 GAAGATTAACAAAAACAAATGGG - Intronic
1108423894 13:50278438-50278460 AAAAATGAACAAGGACAGCTTGG + Intronic
1108595822 13:51948249-51948271 CAAAAAGTACAAATACAGAATGG - Intronic
1108754668 13:53485408-53485430 GAGAATGGAATAATACAGATAGG + Intergenic
1108828066 13:54440733-54440755 GAAAATTGACAAATACACAGAGG - Intergenic
1109045122 13:57400925-57400947 GAAAAAGAAAAAATACTGAATGG - Intergenic
1109075979 13:57835351-57835373 CAAAATTAACAAATACAAAGTGG + Intergenic
1109100449 13:58178013-58178035 GAAAATCAACAAAGAAACATTGG - Intergenic
1109109201 13:58293868-58293890 GAGAATCGACTAATACAGATGGG + Intergenic
1109286952 13:60421132-60421154 GAAAATGAACTAATACAATATGG - Intronic
1109337322 13:61009115-61009137 GAAAATGGACTAATACATATGGG + Intergenic
1109548708 13:63863171-63863193 GAAAATTAACAAACAAACATTGG + Intergenic
1109618002 13:64862507-64862529 GAAAATCAACAAAGACACAATGG - Intergenic
1109791758 13:67258461-67258483 AAAATTAAACAAATAGAGATGGG + Intergenic
1109880253 13:68463954-68463976 GAGAATGAACTAATACACCTAGG + Intergenic
1110088630 13:71415481-71415503 GAAAATCAACAAAGAAACATTGG - Intergenic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110462323 13:75758915-75758937 GAAAATGAACTAATACACACAGG - Intronic
1110645271 13:77876183-77876205 GTAAATCAACAAGTAGAGATTGG + Intergenic
1110768602 13:79308419-79308441 CAAAAAGAAAAAATAGAGATTGG - Intergenic
1110802481 13:79715400-79715422 GAAAATGGACTAATACACTTTGG - Intergenic
1110917237 13:81036697-81036719 GAAAATCAACAAAGAAACATTGG + Intergenic
1111403877 13:87776829-87776851 TAATATGAACAAAAGCAGATGGG - Intergenic
1111414511 13:87921951-87921973 GAAAATGAGTAACTACACATTGG - Intergenic
1111482798 13:88853848-88853870 CAAAATCAACAAATACAAATCGG + Intergenic
1111801550 13:92987090-92987112 GAAAATGGACTAATAGACATAGG + Intergenic
1111811821 13:93100691-93100713 GAAAATGGACCAAGACAGATGGG + Intergenic
1111812260 13:93105789-93105811 GGAAAGGAAAAAGTACAGATTGG - Intergenic
1112120514 13:96405150-96405172 GAAAACGAACTAATACAGCAGGG + Intronic
1112750875 13:102582270-102582292 GAAAATGAACTAATACACATAGG - Intergenic
1112753884 13:102609165-102609187 GAAAAGGAACTAATACAAAAAGG - Intronic
1113152594 13:107281641-107281663 GAAAATGGACTAATACAGTCAGG - Intronic
1113549387 13:111180395-111180417 GGGAAGGAACACATACAGATAGG + Intronic
1113845883 13:113391179-113391201 GAAAATAAAGAAATAAAGAATGG - Intergenic
1113986783 13:114323921-114323943 GAAAATGTACAAATCCATATGGG + Exonic
1114251160 14:20962264-20962286 GAAAATCAACAAAGAAACATTGG + Intergenic
1114992027 14:28299166-28299188 GAGGATGAACTAATACAGAGGGG + Intergenic
1115088069 14:29541001-29541023 GAAAGTCAATAAATACATATAGG + Intergenic
1115456442 14:33609466-33609488 GATAATGTACAAATACATTTGGG - Intronic
1115788151 14:36849250-36849272 AAAGGGGAACAAATACAGATGGG - Intronic
1115793298 14:36904345-36904367 GAAAATTATAAAATACAGAATGG + Intronic
1116056944 14:39875785-39875807 GAAAATGATGAAATACAAACAGG + Intergenic
1116397024 14:44458767-44458789 GAAAATCAACAAAGAAAGACTGG + Intergenic
1116445579 14:45005812-45005834 TACAATAAACAAATACAGAAAGG - Intronic
1116707487 14:48320528-48320550 GAAAAGGAACACATACATAAAGG + Intergenic
1116854875 14:49943360-49943382 GAAAATAGACTAATACAGCTGGG + Intergenic
1117124485 14:52607329-52607351 GAAAATCAACAAAGAAACATTGG - Intronic
1117652780 14:57924213-57924235 GAGAATGAACCAATACAGCTGGG + Intronic
1117744741 14:58857898-58857920 GAAAATCAACAAAGAAACATTGG - Intergenic
1117796264 14:59397364-59397386 CAAATTGAAGAAAGACAGATGGG - Intergenic
1117958783 14:61143329-61143351 GAAAATGGACTAATACAGATGGG - Intergenic
1118051416 14:62032907-62032929 AAAAGTGAACCAATTCAGATGGG - Intronic
1119157228 14:72422261-72422283 GAAAATGGACTAATACAAATGGG + Intronic
1119497235 14:75090338-75090360 GAAAATGAGAAAATACAAATGGG + Intronic
1119636253 14:76275838-76275860 GCACATGAATAAATCCAGATTGG - Intergenic
1119851542 14:77870009-77870031 GAGAATGGACCAACACAGATGGG + Intronic
1120120500 14:80673972-80673994 GAAAATAAACAAAAAGAAATAGG + Intronic
1120258013 14:82143431-82143453 GAAAATGGACTAATACATATAGG + Intergenic
1120338679 14:83190750-83190772 TAAAATTAAGATATACAGATGGG - Intergenic
1120575483 14:86175661-86175683 GAAAATGGACTAATACAGGGAGG + Intergenic
1120588249 14:86343233-86343255 GAAAATTAACAAAGAAACATTGG - Intergenic
1120610952 14:86640718-86640740 GAAAACGAGCTAATACAGAAGGG + Intergenic
1120692182 14:87605175-87605197 GAAGATGGACTAATACACATGGG - Intergenic
1120863785 14:89278065-89278087 GAAAATGGACTAATACAGTGGGG - Intronic
1120919014 14:89737851-89737873 GACAATGAAGAAATTAAGATTGG - Intergenic
1121051059 14:90819167-90819189 GGAAATGAGGAAATACAGGTAGG + Intergenic
1121207348 14:92180456-92180478 GAAAATGGACTAATACAGGTGGG + Intergenic
1121267706 14:92615165-92615187 GAAAATGGACTAATACAAACAGG + Intronic
1121368297 14:93334287-93334309 GAAAATGAAGTAATACAAATTGG - Intronic
1121909397 14:97775681-97775703 GAAACTGTGAAAATACAGATGGG + Intergenic
1122008034 14:98721952-98721974 GAGAATGGACTAATACAGATGGG + Intergenic
1122361979 14:101172863-101172885 GAAAATGGACTAATACAGATTGG - Intergenic
1122458015 14:101870900-101870922 GACAATAAACAATTACAAATGGG - Intronic
1123111782 14:105873749-105873771 GAAAATCAACAAAGAAATATTGG - Intergenic
1123878782 15:24654217-24654239 GACAATGAACATCAACAGATTGG - Intergenic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1124081125 15:26498446-26498468 GAAAATCAACAAAGAAATATTGG - Intergenic
1124238490 15:28010379-28010401 GAAATTAAAGACATACAGATTGG + Intronic
1124387274 15:29220436-29220458 GAAAAATCACAAATACTGATCGG - Intronic
1124665665 15:31589596-31589618 CAAAATGAGAAAATACAGGTGGG - Intronic
1124686377 15:31786258-31786280 GAAAACAAACTAATACAGCTGGG + Intronic
1124745007 15:32332775-32332797 GAAGAAGAACAAAGACAGAAAGG + Intergenic
1125007447 15:34833705-34833727 GAAAATCAACAAAGAAACATTGG + Intergenic
1125258948 15:37800194-37800216 GAAAATAAGCAAATACAGGGTGG - Intergenic
1125306760 15:38326132-38326154 GAAAATGAAGAAAACCATATTGG + Intronic
1126272922 15:46843820-46843842 GAAAATGGACTAATATATATTGG - Intergenic
1126383660 15:48072806-48072828 GAAAATGGACTAATACAGGCTGG - Intergenic
1126480458 15:49113204-49113226 GAAAATTAACAAAGAAACATTGG + Intronic
1126706564 15:51411368-51411390 GAACATGAACAGAGACAGACTGG + Intergenic
1126717425 15:51534038-51534060 CCAAATGTACAAATACAGAATGG + Intronic
1126745351 15:51820388-51820410 GAAAATCAACAAAGAAACATTGG + Intergenic
1126982437 15:54259283-54259305 GAAAATGTACTAATACACTTGGG - Intronic
1127006264 15:54573413-54573435 GAAAATAAACAAATCCAAAATGG + Intronic
1127007390 15:54585523-54585545 CAAAATGGACTAATACAGATGGG + Intronic
1127069995 15:55279517-55279539 AAAAATGTACAACTACAGTTAGG + Intronic
1127174059 15:56335279-56335301 GAAAATGTACATATACACAATGG + Intronic
1127203470 15:56685410-56685432 TACAATGAACAAATAAAAATTGG + Intronic
1127224496 15:56916171-56916193 GAAAATGAACTAAAACACATGGG + Intronic
1127345264 15:58089260-58089282 GAAAATCAACAAAGAAATATTGG + Intronic
1127523222 15:59764469-59764491 GAAAATGCACAAAGAATGATGGG - Intergenic
1127970600 15:63957039-63957061 GAAAATCAACAAAGAAACATAGG - Intronic
1128470895 15:67951602-67951624 GAAAATGGACTAATAGAAATGGG + Intergenic
1128621534 15:69154963-69154985 TATAATGAACAAATACTTATTGG - Intergenic
1128910841 15:71512933-71512955 GAAAATGAAAACATACATCTTGG + Intronic
1129314570 15:74733562-74733584 AAAAATAAACAAATAAAAATTGG - Intergenic
1129500086 15:76027647-76027669 GAAAATCAACAAAGACACACTGG + Intronic
1129571497 15:76689953-76689975 AAAAATGAATAAATAAATATGGG + Intronic
1129585645 15:76861756-76861778 GAAAATGGACTAATACATTTAGG - Intronic
1129593976 15:76944739-76944761 GAAAATGTACATATACACAATGG - Intronic
1129633080 15:77283641-77283663 GAAAATGAATAAATAAGCATGGG - Intronic
1130099980 15:80886028-80886050 GGAAATGAACACATACTGGTGGG + Intronic
1130166383 15:81464121-81464143 GAAAATCAACAAAGAAACATTGG - Intergenic
1130448916 15:84031099-84031121 GAAAATGGACTAATACAGAGGGG + Intronic
1130646671 15:85734126-85734148 GAAAATGACAAAAGACAGCTGGG - Intronic
1131004923 15:88969744-88969766 GAAAATCAACAAAGAAACATTGG - Intergenic
1131163873 15:90128312-90128334 GAAAAAGAAAAAACACTGATAGG - Intergenic
1131190644 15:90313870-90313892 GAAAATCAACAAAGAAACATGGG - Intronic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131852553 15:96558116-96558138 GAAAATGGACTAATACAAAAAGG + Intergenic
1131926075 15:97385358-97385380 GAGAATGCACAAATACACTTGGG - Intergenic
1132052137 15:98615990-98616012 GAAGCTGCACAAATACAGGTTGG - Intergenic
1132311847 15:100862975-100862997 GAAAATAAACAAATAAAGAAAGG + Intergenic
1132427663 15:101732622-101732644 GAAAAAGAAAAAAAACACATAGG + Intergenic
1132647255 16:1004839-1004861 GAAAAAAAAAAAAAACAGATGGG + Intergenic
1132811387 16:1799752-1799774 GAGAATGGACTAATGCAGATGGG + Intronic
1133687549 16:8180372-8180394 AAAAATGAATATATACAGAAGGG + Intergenic
1134600676 16:15531263-15531285 GAGAATGGACTAATACAGTTGGG + Intronic
1134601276 16:15535719-15535741 GAAAATGGACTAATACAAAATGG - Intronic
1134606180 16:15573076-15573098 GAAAATGGACTAATACAACTAGG + Intronic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1134840110 16:17394957-17394979 GAAAATGGACTAATACAGGGGGG - Intronic
1135005141 16:18814239-18814261 GTAAATCAACAAATGCAGAGTGG + Intronic
1135049075 16:19178016-19178038 GAAAACAAACTAATACAGGTTGG - Intronic
1135219131 16:20598263-20598285 GAAAATGTACATATACACAATGG + Intergenic
1135237681 16:20773901-20773923 GAAAATTAACAAAGAAACATTGG - Intronic
1135645456 16:24157618-24157640 GAGAATGGACTAATACACATGGG + Intronic
1135645497 16:24157937-24157959 GAGAATGGACTAATACACATGGG + Intronic
1135723367 16:24835601-24835623 GCAAATGGACTAATACAGATGGG - Intergenic
1135817427 16:25648062-25648084 GAAAATGGACTAATACAAACAGG + Intergenic
1135884084 16:26289431-26289453 GAAAATTAACAAAGAAACATTGG - Intergenic
1136287092 16:29250815-29250837 GAAGAAGAACTAATACAGAGAGG + Intergenic
1137230894 16:46566179-46566201 AAAAATGGAAAAATACAGTTGGG + Intergenic
1137356978 16:47776393-47776415 GAAAATGTACCTATACAGAATGG + Intergenic
1138171169 16:54850964-54850986 GCGAATGAATAAATACAGATAGG - Intergenic
1138778160 16:59750543-59750565 GAAAATGGACAAATACACTCTGG - Intronic
1138965488 16:62079161-62079183 GAAAATAAACAAATACATCCTGG - Intergenic
1138993059 16:62415359-62415381 GAAAGTCAACAAATAAATATTGG - Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1139997957 16:70998151-70998173 GAAAGCTAACATATACAGATTGG + Intronic
1140157820 16:72452125-72452147 GAAAATCAACAAAGAAACATTGG - Intergenic
1140592657 16:76372071-76372093 GAAATAGAACAAAAATAGATGGG - Intronic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1141038238 16:80647640-80647662 GAAAATCAACAAAGAAATATTGG + Intronic
1141045076 16:80708524-80708546 GAGAATGAACGAATACATCTTGG + Intronic
1141049544 16:80747954-80747976 GAAAATGAACAAATATAGAATGG - Intronic
1141176315 16:81721857-81721879 AAAAATGGACAAATACAAAGGGG + Intergenic
1141411277 16:83834801-83834823 GAAAATGGACTAATACATAAGGG + Intergenic
1142471814 17:168937-168959 GAAAATGGACTAATACAGGGAGG + Intronic
1144397173 17:14855846-14855868 AAAAAGGAACACATACAAATGGG - Intergenic
1144538358 17:16113981-16114003 GAAAATGAACTAATACATAATGG - Intronic
1144608901 17:16690950-16690972 GAAAATGGATAAACACAGTTGGG - Intronic
1144810523 17:17995934-17995956 GAAAACAGACTAATACAGATAGG - Intronic
1144903919 17:18624870-18624892 GAAAATGGATAAACACAGTTGGG + Intergenic
1145128665 17:20321872-20321894 GAAAATGGATAAACACAGTTGGG - Intergenic
1145195960 17:20895443-20895465 GAAAATGGATAAACACAGTTGGG + Intronic
1145782806 17:27574555-27574577 AAAAACAAACAAATACAGAAAGG + Intronic
1146487264 17:33253430-33253452 GAAAATGAAAAATTACTGCTAGG + Intronic
1147682505 17:42259958-42259980 TACAATCAACAAATACAAATAGG - Intronic
1148006151 17:44431669-44431691 GAAAATTAAAAAATAAAAATGGG + Intronic
1148317920 17:46720603-46720625 GTAAATGAGCAAATTCAAATGGG - Intronic
1149097432 17:52860373-52860395 AAAAATAAATAAATATAGATGGG - Intergenic
1149143303 17:53459252-53459274 GAAAATGAACTAATACAGATGGG + Intergenic
1149145654 17:53490007-53490029 GACAATGAACTAACACAGATAGG - Intergenic
1149157106 17:53644933-53644955 GAAAATCAACAAAGAAACATTGG - Intergenic
1149231450 17:54538680-54538702 GAAAATCAACAAAGAAACATTGG + Intergenic
1149251653 17:54777239-54777261 GAAAATGAACTAATGCAGTAAGG + Intergenic
1149260879 17:54878175-54878197 AAAAATGGACTAATACAGTTTGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1149397109 17:56256106-56256128 GAAAATGAAGGAATTCAGAGTGG - Intronic
1149770555 17:59317545-59317567 GGAATTGAACAAATCCAGCTAGG - Intergenic
1149819498 17:59761228-59761250 GAAACTGAACAAATCCAGTCAGG - Intronic
1149900819 17:60476132-60476154 GAAAATGAATAAATGGAAATAGG + Intronic
1149943476 17:60896351-60896373 GAAAATCAACAAAGAAACATTGG - Intronic
1150537847 17:66062201-66062223 GAAAATGGACTAATACATAGTGG + Intronic
1150856199 17:68755416-68755438 GAAAACGGACTAATACAGAGAGG - Intergenic
1151039272 17:70839879-70839901 GAAAACAGACTAATACAGATGGG - Intergenic
1151042761 17:70882816-70882838 GCAATTGCAGAAATACAGATGGG + Intergenic
1151135995 17:71946184-71946206 GAAAACAAACTAATAAAGATGGG + Intergenic
1151280545 17:73070942-73070964 GAAAATGAACTAATACACCTAGG + Intronic
1151647988 17:75446687-75446709 AAAAATAAACAAATAAAAATAGG + Intronic
1152160707 17:78666906-78666928 GAAAAGGAATGAATACAGCTGGG - Intergenic
1153126223 18:1794807-1794829 AAATATAAACAAAGACAGATGGG - Intergenic
1153339078 18:3955925-3955947 AAAAATGAACAAAAATACATTGG + Intronic
1153729450 18:7994428-7994450 GAAAATCAACAAAGAAATATTGG + Intronic
1154130980 18:11736951-11736973 GAATATGAAAACATACAGATAGG + Intronic
1154165647 18:12012367-12012389 GAAAATAAACAAGTCCAGACTGG + Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154465064 18:14635690-14635712 AAAAATAAAAAAATAAAGATGGG + Intergenic
1155134421 18:22974274-22974296 CAAATTAAATAAATACAGATAGG + Intronic
1155381922 18:25232121-25232143 GAAGAAGCACAAATACTGATGGG + Intronic
1155767048 18:29649009-29649031 GAAAATAAACTAATACAGGAAGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156528632 18:37793724-37793746 GAAAATAAAGAAATGCAAATAGG - Intergenic
1156589386 18:38468868-38468890 GTAAGTGAAGAAATACTGATTGG + Intergenic
1156644932 18:39149507-39149529 GAGAATGGACTAATACATATGGG - Intergenic
1156687304 18:39665972-39665994 GAGAATGGACTAATACAGAGAGG - Intergenic
1156769295 18:40699434-40699456 GAAAATGGACCAATACAACTGGG + Intergenic
1156836515 18:41561639-41561661 AAAAATAGACTAATACAGATGGG + Intergenic
1156969147 18:43133890-43133912 GAAAATGAATGAATACAGTTAGG + Intergenic
1156977558 18:43242039-43242061 GTAAATAAACAAATAGAAATAGG + Intergenic
1157698904 18:49747012-49747034 GAAAATGGACTAATACAGGAGGG + Intergenic
1157821147 18:50770498-50770520 GAAAATTAACAAAGAAACATTGG + Intergenic
1157875553 18:51270175-51270197 GAAAATGAACTAATACAAGAGGG - Intergenic
1157875597 18:51270486-51270508 GAAAATGAACTAATACGGCCGGG - Intergenic
1158468889 18:57716782-57716804 GAAAATCAACAAAGAAACATGGG + Intronic
1158659864 18:59377036-59377058 TAAAATTCATAAATACAGATTGG - Intergenic
1158664484 18:59420335-59420357 GAAAATGAAGGAACACAGAGGGG - Intergenic
1159077581 18:63699347-63699369 GAAAATGAACTAATACAATTAGG - Intronic
1159131292 18:64282467-64282489 GAAAATGGATTAATACAGGTGGG + Intergenic
1159179511 18:64883693-64883715 AAATATGAATAAATACAGTTGGG - Intergenic
1159504699 18:69320655-69320677 GAAAATTAACAAAGAAACATTGG - Intergenic
1159543418 18:69810447-69810469 GAAAATGAAAATAGACAAATGGG + Intronic
1159599316 18:70413614-70413636 GGACATGAACAAATACAGATGGG + Intergenic
1159711203 18:71763216-71763238 GAAAATGAACTAATACAAGACGG - Intronic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1159799538 18:72880299-72880321 GAAAATGGACTTATACAGTTGGG + Intergenic
1159802419 18:72918124-72918146 GAAAATCAACAAAGAAACATTGG - Intergenic
1160138226 18:76293625-76293647 GAAAATCAACAAAGAAACATTGG - Intergenic
1160682784 19:419458-419480 GAAAAGGAAAACATGCAGATGGG + Intronic
1161535168 19:4814686-4814708 GAAAAAAAAAAAATAGAGATGGG + Intergenic
1161700820 19:5794142-5794164 AAAAAGAAACAAAAACAGATGGG + Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1163409485 19:17144992-17145014 GAAAAAGAAAAAATAGAGACTGG + Intronic
1163462548 19:17447939-17447961 AAAATTGAACAAATATAGAATGG + Intronic
1164577242 19:29412706-29412728 GAAAATGGACTAATACACTTGGG + Intergenic
1165213939 19:34255535-34255557 GATAATCAATAAATACAGATAGG + Intronic
1165259447 19:34599331-34599353 GAAAAGAGACTAATACAGATGGG - Intronic
1165411278 19:35663575-35663597 TAAAATGAAAAAATTCAAATGGG - Intergenic
1166022513 19:40045293-40045315 GAAAATTAACAAAGAAACATTGG + Intronic
1166263074 19:41656656-41656678 GAAAATGGACTAATACAGATAGG - Intronic
1166285416 19:41823370-41823392 GAAAATCAACAAAGAAACATTGG - Intergenic
1166352191 19:42204635-42204657 AAAAATGAACTAACAAAGATGGG + Intronic
1166577767 19:43859263-43859285 GAAAATTAACAAAGAAATATTGG + Intergenic
1166936428 19:46336033-46336055 GAAAATAAATAAATAGAGACAGG - Intronic
1167382600 19:49147388-49147410 AAAAATAAACAAATACAGCCAGG + Intronic
1167403645 19:49289672-49289694 GAAAATGAACTAATACAGACTGG + Exonic
1167438155 19:49491764-49491786 GAAAATTGACAAATACACAGAGG + Exonic
1167929079 19:52849035-52849057 GAAAATGCAAAAATACACAAGGG + Intronic
1167966174 19:53149184-53149206 GAAAATGAAAAGATACACAGGGG + Intronic
1168013147 19:53550271-53550293 GAAAATCAACAAGTAAACATTGG - Intronic
1168449282 19:56451424-56451446 GAAAATCAACAAAGAAACATCGG + Intronic
1202701363 1_KI270712v1_random:167261-167283 GTAAATGAATAAAATCAGATAGG + Intergenic
924968908 2:105789-105811 AAAAATCAACAAAGACACATTGG - Intergenic
925325264 2:3014686-3014708 GAAAATGAACAAAGACACTTTGG + Intergenic
925403840 2:3592530-3592552 GAAAATTAAAAAGTATAGATTGG - Intergenic
925758780 2:7163399-7163421 GAAGTTGAACAAAGATAGATGGG - Intergenic
926124120 2:10261220-10261242 GCAAATGAATAAAGACAGACAGG - Intergenic
926348540 2:11973136-11973158 GAAAATTAACAAAGAAACATTGG - Intergenic
926729535 2:16025788-16025810 GAAAACGGACTAATACATATGGG - Intergenic
926987618 2:18640732-18640754 GAAAATGAAGAAAAACAGGGTGG - Intergenic
928340847 2:30441921-30441943 GAAAATAAAAAAATACAGCCGGG + Intergenic
928749682 2:34457355-34457377 GAGAATGGACTAATACAGAGAGG - Intergenic
928848955 2:35718313-35718335 GAGAATGAACTAATACAGCATGG + Intergenic
929010455 2:37437890-37437912 GAAAATTGACTGATACAGATGGG - Intergenic
929381830 2:41363022-41363044 GAAAATGAAGAAAAAGAGAATGG + Intergenic
929774620 2:44921251-44921273 AAAAAAGAACAAAAACAGAAGGG + Intergenic
930118547 2:47740852-47740874 AAAAATGAAAAAATTCAGCTGGG - Intronic
930139509 2:47937297-47937319 GAAAACAAACAAATAAAAATAGG - Intergenic
930252981 2:49056615-49056637 GAAAATCAACAAAGAAACATTGG + Intronic
930284130 2:49406726-49406748 GCAAAAGAAGACATACAGATGGG - Intergenic
930309798 2:49726276-49726298 GAAAATGGCCTAATACAGGTGGG - Intergenic
930324157 2:49893044-49893066 GAAAAGCAACAAATCCAGGTGGG - Intergenic
930427681 2:51233143-51233165 GATAATGGACTAATACAGATAGG - Intergenic
930457351 2:51622299-51622321 GAAAATGGACTAATACATATAGG - Intergenic
930948138 2:57101511-57101533 GAAAATAAACAAAGAAACATTGG - Intergenic
931535744 2:63273950-63273972 GAAAATTAACAAAGAAACATTGG + Intronic
932061325 2:68501836-68501858 CAAAATGAACTAAGACATATAGG - Intronic
932101364 2:68902368-68902390 GAAAATCAACAAAGAAATATTGG + Intergenic
932267858 2:70383679-70383701 GAAAATGAACTAATACAAGAAGG + Intergenic
932657472 2:73622669-73622691 GAAAATGGACTAATACACATGGG + Intergenic
932664138 2:73682936-73682958 GAAAATGGACTAATACACATGGG + Intergenic
932932750 2:76061897-76061919 CAAAATGAAGAAAAACACATAGG - Intergenic
933014038 2:77101624-77101646 AAAAATAAATAAATAAAGATGGG - Intronic
933168175 2:79097182-79097204 GAAAATGCCCAAATCCAGGTAGG - Intergenic
933296048 2:80492405-80492427 GAGAATGGACTCATACAGATGGG + Intronic
934020100 2:87940438-87940460 GAAATTGAAAATATAAAGATAGG + Intergenic
934172277 2:89550707-89550729 GTAAATGAATAAAATCAGATAGG + Intergenic
934282589 2:91625059-91625081 GTAAATGAATAAAATCAGATAGG + Intergenic
935067860 2:99666790-99666812 GAAAATGACCAGAGACAGAGTGG + Intronic
935288398 2:101587591-101587613 GAAAATCAACAAAGAAACATTGG - Intergenic
935473778 2:103492536-103492558 TAAAATGAGCAAATTCATATAGG + Intergenic
936431540 2:112468390-112468412 CAAAATCAACAAATAAAAATTGG + Intergenic
936640695 2:114309226-114309248 GAAAATCAACAAAGAAACATTGG - Intergenic
937345012 2:121120027-121120049 GAAAATGGACTAATACAGTAGGG - Intergenic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
937777943 2:125803536-125803558 GAGAATGGACTAATACAGATGGG - Intergenic
937793731 2:125992092-125992114 GAAAATCAACAAAGAAACATTGG - Intergenic
938411283 2:131066842-131066864 GAGAATGAACTAATACAACTGGG - Intronic
938418336 2:131123204-131123226 GAAAATTAACCCATACATATGGG - Intronic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
938744087 2:134260549-134260571 AAAAAGGAACAAAAACAGGTTGG + Intronic
938975842 2:136477547-136477569 GAAAATGAACAAAGAAACATTGG - Intergenic
939106167 2:137951129-137951151 GAAATTGAAAAACTACATATTGG - Intergenic
939137223 2:138311977-138311999 GAAAAGTAATAAATACAAATAGG - Intergenic
939346929 2:140977416-140977438 GAAAATGGACTAATACATATGGG + Intronic
939363474 2:141203629-141203651 GAAAATTAACAAATACATTCAGG + Intronic
939410009 2:141813156-141813178 GAAAATAAATAAATAAAAATAGG + Intronic
939848373 2:147275061-147275083 GAAAATGAATAAACAGATATTGG - Intergenic
940395944 2:153192537-153192559 GAAAATCAACAAAGAAACATTGG - Intergenic
940425819 2:153531134-153531156 AAAAATGAACTGATACAGATGGG - Intergenic
940433169 2:153618562-153618584 GAAAATCAACAAATATGCATTGG - Intergenic
940749459 2:157609509-157609531 GAAAATGAACAAAGAAACATTGG - Intronic
940757683 2:157701995-157702017 GAAAAGGAACAAAGAAACATTGG + Intergenic
940786103 2:157982383-157982405 GAAAATCAACAAAGAAACATTGG - Intronic
940795694 2:158075223-158075245 GAAAATTAACAAAGAAACATTGG + Intronic
940867386 2:158830871-158830893 GAAAATAAACAAAATTAGATGGG + Intronic
941057484 2:160805801-160805823 GAAAATGGACTAATACAGATAGG - Intergenic
941128923 2:161622421-161622443 GAAAGTGAAGAGAAACAGATGGG - Intronic
941308736 2:163903422-163903444 GAAAATGAAAACACACAGACTGG + Intergenic
941418655 2:165255226-165255248 GAAGAAGAAAAAATAAAGATGGG - Intronic
941524886 2:166594958-166594980 GAAAATCAACAAAGAAACATTGG + Intergenic
941590318 2:167411836-167411858 GAAAATGTATATATACAGAATGG + Intergenic
941688953 2:168478375-168478397 GAACATGAACACCTCCAGATTGG - Intronic
941851542 2:170188007-170188029 GAAAATCAACAAAGAAACATTGG - Intronic
942001242 2:171649750-171649772 GAAAATCAACAAAGAAACATTGG - Intergenic
942250589 2:174044438-174044460 GCAAAGATACAAATACAGATTGG + Intergenic
942518777 2:176781372-176781394 GAAAATAAGCAAATAAAAATGGG - Intergenic
942583858 2:177452729-177452751 AAAGAAGAACAAAAACAGATGGG - Intronic
942750487 2:179281066-179281088 GAAAATCAACAAAGAAACATTGG + Intergenic
942845346 2:180417684-180417706 GAAAATGGACTAATACAGTGAGG + Intergenic
942915261 2:181297469-181297491 TAAAATCAACAAATAAACATTGG + Intergenic
943067476 2:183104339-183104361 GAAAATCAACAAAGAAACATTGG - Intergenic
943156175 2:184181141-184181163 GACAATGAACAAACAGATATAGG - Intergenic
943259482 2:185640624-185640646 AAAAATGAGCTTATACAGATTGG + Intergenic
943519257 2:188927233-188927255 GAAAATCAATAAATAAACATTGG - Intergenic
943636129 2:190308754-190308776 GAAAATGGACTAACACAGTTAGG + Intronic
943811218 2:192192403-192192425 GCAAAAGAACAATTAAAGATGGG - Intronic
943907396 2:193517156-193517178 GCAAATGAACTAATACATATAGG - Intergenic
943950167 2:194123803-194123825 GAAAATCAACAAATAAATAATGG + Intergenic
943980622 2:194545000-194545022 GAAAATTAACAAAGAAACATTGG + Intergenic
944092303 2:195925411-195925433 GAAAAAGGAAAAATACACATGGG + Intronic
944268161 2:197750745-197750767 GAAAATTAACAAATATAGTCAGG + Intronic
944386289 2:199168568-199168590 GAAAATGGACTAATACATTTGGG + Intergenic
944503785 2:200388973-200388995 GAAAAACGACAAAGACAGATGGG - Intronic
944827826 2:203503276-203503298 GAAAACAGACTAATACAGATGGG - Intronic
945130073 2:206561605-206561627 GAAAATGAAAATATATACATAGG - Intronic
945358039 2:208861503-208861525 GAAAATGGACTAATACACTTGGG + Intergenic
945475985 2:210283294-210283316 GAAAATCAACAAATAAACATTGG - Intergenic
945567100 2:211414161-211414183 GAAAATGATCAAAAACATTTTGG - Intronic
945570397 2:211459783-211459805 GAAAATGGACTAATACAGGAGGG + Intronic
945575922 2:211528458-211528480 GAAAATCAACAAAGAAATATTGG + Intronic
945803121 2:214458959-214458981 GAAAATCAACAAGGACACATTGG - Intronic
946023152 2:216655601-216655623 GAAAATGGACTAATACAGTCAGG + Intronic
946092158 2:217237233-217237255 GAAAATTAACAAATACATTCAGG - Intergenic
946181540 2:217952005-217952027 GAACATGAACACAGCCAGATGGG + Intronic
946513770 2:220388828-220388850 GAAAATTAACAAAGAAACATTGG - Intergenic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
946729348 2:222693471-222693493 GAAAATGAACTAATACAAAATGG - Intronic
946753454 2:222917675-222917697 GAAAAAGAACATATACAAATAGG - Intronic
946832031 2:223736941-223736963 GAAAATGGACTAATACATAAAGG + Intergenic
947127591 2:226886882-226886904 GAAAAGGAACAAATAAATAGAGG + Intronic
947341457 2:229143946-229143968 GAAAATGGACTAATACAGGGGGG + Intronic
947453320 2:230228767-230228789 GTAAATATAAAAATACAGATAGG - Intronic
947527656 2:230889051-230889073 GAACATGGACTAATACAGAGAGG - Intergenic
948299437 2:236890965-236890987 GAGAACGGACTAATACAGATGGG + Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
1168730156 20:70416-70438 GAAGATGAGCAAATCCAAATAGG + Intergenic
1168827963 20:826678-826700 GAAAACGAACTAATACAGCACGG + Intergenic
1168870553 20:1124010-1124032 GAAAATGAACAATAACAATTGGG - Intronic
1168899594 20:1351763-1351785 GAAAATCAACAAAGAAACATTGG - Intronic
1169052523 20:2592995-2593017 GAACATGAACTAATACAATTGGG - Intronic
1169083672 20:2814340-2814362 GAAAATGAACATATAATGAAGGG - Intergenic
1169175502 20:3508588-3508610 TCAGATGAACAAATACAGAGGGG + Intronic
1169498165 20:6134294-6134316 GAAAATGAACTAATACACCCTGG + Intergenic
1169522323 20:6387065-6387087 GAGAATGAACTAATACAGGAAGG + Intergenic
1169726275 20:8736501-8736523 GAAAATGGACAAACACAGGTTGG - Intronic
1169760378 20:9085868-9085890 GAAAATGAACTAATTCCCATGGG - Intronic
1170136216 20:13076208-13076230 GGAAATGAATAAATAAAGAGAGG + Intronic
1170434646 20:16313812-16313834 GATAATGAACAAATACATTATGG - Intronic
1170717317 20:18843259-18843281 AAGAATGAACTAACACAGATGGG - Intergenic
1170988781 20:21283172-21283194 GAAAAAGAACAAATGGAGAAAGG - Intergenic
1171091901 20:22293267-22293289 GAAAATGGAATAATACAGAAGGG + Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1172249351 20:33467948-33467970 AAAAAAAAAAAAATACAGATGGG + Intergenic
1172381804 20:34500219-34500241 GAAAATCAACAAAGAAACATTGG - Intronic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173264042 20:41461678-41461700 GAAAATGAACCAATACATCCTGG + Intronic
1173366423 20:42389692-42389714 AAAAATTAAGAAATACAGCTGGG + Intronic
1173429705 20:42976054-42976076 GAAAATGAATGTATACAGAGAGG + Intronic
1173611366 20:44370714-44370736 CGGAATGAGCAAATACAGATGGG + Intronic
1173964715 20:47103425-47103447 GAAAATGGACTAATACACAATGG - Intronic
1174179126 20:48664015-48664037 CAGAATGAACAAAGACAGAAAGG + Intronic
1174285879 20:49472995-49473017 CAAAATGGACTAATACAGATAGG + Intronic
1174651767 20:52131820-52131842 GAAAATCAACAAAGAAACATCGG + Intronic
1174691121 20:52506232-52506254 GAAAATCAACAAAGAAACATTGG + Intergenic
1175024236 20:55884788-55884810 GAAAACAGACAAATACAGATGGG + Intergenic
1175454514 20:59101523-59101545 GAAAACGAATAAAGACAGAAAGG - Intergenic
1176989718 21:15480801-15480823 ATGAATGAACAAATAAAGATAGG + Intergenic
1177273404 21:18876903-18876925 AAGAATGAACTAATATAGATGGG - Intergenic
1177327641 21:19612859-19612881 GAAAAGCAACGAATACAGAGAGG + Intergenic
1177373562 21:20238761-20238783 GAAATTCAACAAATAAATATTGG - Intergenic
1177726438 21:24974157-24974179 GTAAAGGAACAAAAACAGACAGG + Intergenic
1177757259 21:25362380-25362402 GAAAATTGACAAATACACAGAGG + Intergenic
1177822396 21:26045821-26045843 GCAAATGAACTAATACAGCTCGG - Intronic
1177851000 21:26348607-26348629 GAAAAAGAAGAAAAAGAGATGGG - Intergenic
1177925701 21:27211808-27211830 GAAAATGGACTAATACACAAGGG + Intergenic
1177970362 21:27781318-27781340 GAAAATCAACAAAGAAACATTGG + Intergenic
1178178911 21:30136838-30136860 GGAAATGAAGAAATAAAGCTAGG - Intergenic
1178234558 21:30825729-30825751 GAAAATGATCAAATAGTGATGGG + Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178616726 21:34141066-34141088 GAAAAGGAACAAATTCAGCAAGG - Intronic
1178623151 21:34193916-34193938 GAAAATGGACTAATACAGACAGG + Intergenic
1178740306 21:35193893-35193915 GAAAATGGACTAATACAGATGGG - Intronic
1179196404 21:39167406-39167428 GAAAATGAACATACAAAAATAGG - Intergenic
1179322180 21:40302505-40302527 AAAAATGGACTAATACAGAGCGG + Intronic
1179561008 21:42216255-42216277 GAAAATGGACTAATACAGACAGG + Intronic
1180005111 21:45017078-45017100 GAACTTGAGAAAATACAGATTGG + Intergenic
1180103711 21:45602778-45602800 GAAAATTAACAAATAAGCATTGG - Intergenic
1180138984 21:45879767-45879789 GAAAATGAAAAAAAACCTATAGG + Intronic
1180686332 22:17669960-17669982 GAAAATGGACTAATACACATGGG + Intronic
1181117159 22:20639310-20639332 AAAAATAAAAAAATAAAGATGGG - Intergenic
1181155303 22:20916683-20916705 GAAAACAAACAAAAACAAATAGG + Intergenic
1181303210 22:21897014-21897036 AGAAATAAAGAAATACAGATTGG - Intergenic
1181303893 22:21903151-21903173 GAAAAGGAAAAAAGACAAATGGG + Intergenic
1182201628 22:28577507-28577529 GAAAATCCACAAATAAACATTGG - Intronic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182364749 22:29770980-29771002 GAAAATGGACTAATACACAAGGG + Intergenic
1182390956 22:29995606-29995628 GAAAAGGGACAAAGGCAGATAGG + Intronic
1182533156 22:30977923-30977945 GAAAATGAACAATTACATACAGG - Intergenic
1183159425 22:36101858-36101880 CAGAATGAACTAATACGGATGGG + Intergenic
1183974253 22:41501555-41501577 GAACCTGAACAACTGCAGATGGG + Intronic
1184386408 22:44178178-44178200 GGAAATGGACTAATACACATAGG + Intronic
1184966061 22:47973089-47973111 GAAAATGGAAAATTCCAGATTGG - Intergenic
1185120594 22:48966660-48966682 GAAAGAAAACAAATACAGATTGG + Intergenic
949238009 3:1834273-1834295 AAAAATGAACAATTTTAGATAGG - Intergenic
949704013 3:6794542-6794564 GAAAATGAAGAACCTCAGATAGG - Intronic
949818031 3:8082778-8082800 GAAAATCAACAAATAAACATTGG - Intergenic
950146184 3:10651590-10651612 GAAAATGGAGTAACACAGATGGG + Intronic
950600457 3:14030127-14030149 TGGAATGAACAAAGACAGATTGG - Intronic
950780657 3:15388867-15388889 AGGAATGAACAAATACAGCTCGG + Intronic
951083955 3:18488285-18488307 GAAAATGAACACATATGGAAGGG - Intergenic
951096502 3:18638055-18638077 GAAAATGTACATATACACAATGG + Intergenic
951310017 3:21114195-21114217 GAAAATCAACAAAGAAACATCGG - Intergenic
951314723 3:21175890-21175912 GAAAATCAACAAAGAAACATTGG - Intergenic
951331299 3:21372032-21372054 GGAAATTAAAATATACAGATTGG - Intergenic
951380242 3:21975193-21975215 GAAAATGTACATATACACAATGG + Intronic
951492320 3:23285239-23285261 GAAAATGGACACATACACAACGG - Intronic
951605183 3:24425380-24425402 GAGAATAAAGAAATACAAATAGG - Intronic
951624765 3:24647036-24647058 GAAAATGAACTAAGACAAGTAGG - Intergenic
951625647 3:24660324-24660346 GAAAATTAACAAATAAACATTGG - Intergenic
951781371 3:26366630-26366652 GAAAATCAATAAATACATCTTGG - Intergenic
951953178 3:28224443-28224465 GAAAATGGACTAATACAAGTGGG - Intergenic
952348466 3:32510832-32510854 GGAAAGGGACAGATACAGATGGG + Intergenic
952611345 3:35214580-35214602 GAAAATGAACTAATACAATATGG - Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
952939964 3:38435543-38435565 GAAAATCAACAAATAAACATTGG + Intergenic
953087581 3:39685847-39685869 GAAAATCAACAAAGAAATATTGG + Intergenic
953100916 3:39826677-39826699 GAATATGAACAAAGAAACATTGG - Intronic
953262010 3:41348813-41348835 AAAAATGAACAAACACGGTTTGG + Intronic
953440842 3:42915788-42915810 GAAAATAAGCAAATAAAAATGGG - Exonic
953456607 3:43047308-43047330 GAGAATGGACTAATACAGGTGGG + Intronic
953610115 3:44440704-44440726 GAAAGTAAAGAAATACAGAATGG + Exonic
953806185 3:46070323-46070345 GAAAATTAACAAAGAAACATTGG - Intergenic
954383583 3:50232794-50232816 GACAGAGAACAAATACAGATTGG + Intronic
954491893 3:50914730-50914752 GAAAATCAACAAAGAAACATTGG - Intronic
954591735 3:51788997-51789019 GAAAATGAGCTAATACAGGTAGG + Intergenic
954596935 3:51833403-51833425 GAAAAAGAACATATACATATAGG - Intergenic
954879844 3:53826767-53826789 GAAAAGGAAAAGGTACAGATTGG + Intronic
955146733 3:56327109-56327131 GAAAATGGACTAATACACATTGG - Intronic
955589797 3:60522854-60522876 GAAAACCAACAAAAACAGATGGG - Intronic
955902998 3:63777195-63777217 CAAAATGGACTAACACAGATAGG + Intergenic
955944842 3:64183185-64183207 GAATTTGAACAAATACAATTAGG + Intronic
956083629 3:65586736-65586758 GAACATGAACAATTTCAAATTGG + Intronic
956298100 3:67736920-67736942 GGAATTTAACAAATACAAATGGG - Intergenic
956581956 3:70823927-70823949 GGAAATAAGCAAATACAGAATGG + Intergenic
957555305 3:81759169-81759191 GAAAACGGACTAATACAGAAGGG + Intronic
957606316 3:82403854-82403876 GAAAAAGAACTGATACAGGTAGG + Intergenic
957645792 3:82923745-82923767 TTAAATGAAAAGATACAGATAGG + Intergenic
957831769 3:85530680-85530702 GAGAATGGATTAATACAGATAGG + Intronic
957966391 3:87326473-87326495 GAAAATCAACAAAGAAACATTGG + Intergenic
958139422 3:89542321-89542343 CAAAATGAACAATTACAGACTGG - Intergenic
958418060 3:93900258-93900280 GAAATTTAAGAAATACTGATCGG - Intronic
958631948 3:96696581-96696603 GAAAATAAACAAAGAAACATTGG - Intergenic
958638364 3:96775140-96775162 GAAAATGGACTAATACAGGTGGG - Intergenic
958663604 3:97105140-97105162 GATAATAAACAAATTCAGAGTGG - Intronic
958710514 3:97711359-97711381 GAAAATGGACTAATACAGTCAGG + Intronic
958733781 3:97987539-97987561 AAAAATGAACAAATAGAGAGAGG + Intronic
958770114 3:98415604-98415626 AAGAATGAACTAATATAGATGGG + Intergenic
958799487 3:98738602-98738624 GAGAATGAACTAATACAGATGGG + Intronic
959191383 3:103115918-103115940 GAAAATCAACAAATAAATATTGG + Intergenic
959214661 3:103436580-103436602 GAAAACGGACTAATACAGAGAGG - Intergenic
959279472 3:104319595-104319617 GAAAATCAACAAAGAAACATTGG + Intergenic
959293504 3:104504606-104504628 GAAAATCAACAAAGAAATATTGG + Intergenic
959370580 3:105520496-105520518 GAACATGAACAAATGAAGAAAGG - Intronic
959547159 3:107610397-107610419 GAAAATTAACAAAGAAACATTGG - Intronic
959646006 3:108702100-108702122 GAAAATCAACAAAGAAACATTGG - Intergenic
959707648 3:109353865-109353887 GAAAATAACAAAAAACAGATTGG - Intergenic
959846357 3:111038429-111038451 GAAAATGAACAAAGAAACATTGG + Intergenic
959879861 3:111430691-111430713 GAAAATCAATAAACAAAGATTGG + Intronic
959886815 3:111512108-111512130 GCAAATGAACTAACACAGAGAGG + Intronic
960014239 3:112868837-112868859 AAAAATCAACAAATAAACATTGG - Intergenic
960052073 3:113248595-113248617 GAACATTAACAAATAAGGATGGG - Intronic
960067468 3:113388975-113388997 GAAAATGAACAAGGAAACATTGG + Intronic
960462360 3:117952001-117952023 GAGAATGAACTAATACAGATGGG + Intergenic
960535436 3:118809852-118809874 GAAAATGGACTAATACAGACAGG - Intergenic
960716884 3:120584665-120584687 AAAAAAGAAAAAATACATATAGG + Intergenic
961342983 3:126242144-126242166 GAAAATGGACTAATAAATATTGG + Intergenic
961917843 3:130395819-130395841 TAAAATAAACATTTACAGATTGG + Intronic
962018685 3:131472731-131472753 TAAAATTAACATATACAAATTGG + Intronic
962162007 3:133010603-133010625 GAAAATGAACTAATACACACAGG - Intergenic
962322500 3:134403449-134403471 GAAAATGAACTAATACACCATGG + Intergenic
962584515 3:136828280-136828302 GAAAATCAACAAAGAAACATTGG - Intronic
962821546 3:139052680-139052702 GAAAATCAACAAAGAAACATTGG - Intronic
963089417 3:141468651-141468673 AAAAATGAAAACAGACAGATAGG - Intergenic
963282819 3:143402882-143402904 TAAAATCAACAAATAAACATAGG - Intronic
963347988 3:144118855-144118877 GAAAATGGTCTAATACAAATAGG + Intergenic
963362916 3:144299810-144299832 GAAAATCAACAAAGAAACATTGG - Intergenic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963497159 3:146079901-146079923 AAACATGAAGAAATACAGCTGGG + Intronic
963758656 3:149262183-149262205 GAAAATCAACAAAGAAACATTGG + Intergenic
963824895 3:149942670-149942692 GAAATAGAAAACATACAGATTGG - Intronic
963858676 3:150283666-150283688 GAAAATGTACATATACACAATGG + Intergenic
963863919 3:150340136-150340158 AAAAATGAGCAAATCCAGAAGGG - Intergenic
963941968 3:151104629-151104651 GGAAATGAAAACATACAGGTAGG - Intronic
963996348 3:151714004-151714026 GAAAATTAACAAAGAAACATTGG + Intergenic
964037780 3:152219277-152219299 TGAAATGCACAAATACAGAGGGG + Intergenic
964253959 3:154753102-154753124 GAAAATCAACAAAGAAACATCGG + Intergenic
964600182 3:158491935-158491957 GAAAATGGACTAATACACACAGG - Intronic
964654715 3:159053151-159053173 GAAAACGAACTAATACACCTGGG + Intronic
964803708 3:160583457-160583479 GAAAATCAACAAAGAAACATTGG + Intergenic
964871972 3:161322698-161322720 GAAAATCAACAAAGAAACATTGG + Intergenic
964934624 3:162067123-162067145 GAAAATTAACAAAAACATTTAGG + Intergenic
965014386 3:163138447-163138469 GAAAATCAACAAAGACACATGGG - Intergenic
965407131 3:168284277-168284299 GAAACTGTACATATACACATAGG - Intergenic
965616578 3:170599972-170599994 ACAAATGGACAAATACTGATGGG - Intronic
965867232 3:173219156-173219178 GATAATGAACAAAGAAACATCGG - Intergenic
966145096 3:176802233-176802255 GAAAATTAACAAAGATAGTTAGG + Intergenic
966359299 3:179117496-179117518 GAAAATCAACAAAGAAACATTGG + Intergenic
966463892 3:180207438-180207460 GAAAATCAACAAAGAAACATTGG + Intergenic
966533931 3:181009873-181009895 AGAAATGAACAAAGACAGCTTGG + Intergenic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
966811318 3:183847402-183847424 AAAAATGAACAAAATCAGCTGGG + Intronic
966981057 3:185136194-185136216 GAAAATTACCAGATACAGAGAGG + Intronic
967040490 3:185687778-185687800 GAAAGTTAACAAAAACAGGTAGG - Intronic
967379581 3:188842641-188842663 TAAAATGAATAAATAAAAATAGG - Intronic
967510012 3:190300257-190300279 GATAATGAGTAAATACAGAGGGG + Intergenic
967558778 3:190894013-190894035 GAGAATGAACTAATACAGGCAGG - Intergenic
968644650 4:1734088-1734110 GAGAATGAGCAAATACTGCTAGG + Intronic
968841761 4:3012215-3012237 GAAAATGATTAAATACATATTGG + Intronic
969027468 4:4185148-4185170 GTAAATGAATAAAATCAGATTGG - Intergenic
969074861 4:4569901-4569923 GAAAACAGACAAATACAGATAGG - Intergenic
969081753 4:4624539-4624561 GAAAACAAACTAATACAGATGGG - Intergenic
969336597 4:6513980-6514002 AAAAATGTTCAAATACAGATGGG + Intronic
969726934 4:8925000-8925022 GAAAATAAACAAAGAAACATTGG + Intergenic
969948938 4:10813753-10813775 GAAAATGGACTAAAACAGGTAGG - Intergenic
970185874 4:13452812-13452834 GAAAATCAACAAATAAACATTGG - Intronic
970279933 4:14443884-14443906 GAAAATGGACTAATACATCTGGG + Intergenic
970475696 4:16420621-16420643 GAAAATCAACAAAGAAACATAGG - Intergenic
970509066 4:16762378-16762400 GAGAATGAATTAATACAGAGGGG - Intronic
970718641 4:18959263-18959285 GAAAATGGATGAATACAGAAGGG - Intergenic
970757725 4:19446355-19446377 GAAAATTAACAAATAAACATTGG + Intergenic
971021839 4:22545206-22545228 GAAAATGTACTAATACAGGAGGG - Intergenic
971070128 4:23081462-23081484 GAAAATGGACTAATACAACTGGG + Intergenic
971439861 4:26672157-26672179 GAAAATGAACATGTACGTATTGG + Exonic
971454805 4:26834271-26834293 GAGAATGGACTAATACAGGTTGG + Intergenic
971459422 4:26878648-26878670 GAAAATGAACTAATACAGATGGG - Intronic
971656705 4:29355828-29355850 TAAAATAAAAAAATACATATTGG - Intergenic
971753469 4:30679434-30679456 GAAAGTGGACTAATTCAGATAGG + Intergenic
971914219 4:32847619-32847641 GAAAATCAACAAAGAAACATTGG - Intergenic
972220451 4:36949149-36949171 GAGAATGGACTAATACAGATGGG - Intergenic
972892150 4:43570926-43570948 CAAAATGAACATATACATACGGG + Intergenic
973081298 4:45997197-45997219 GAGAAAGAACAAATACAGCAGGG - Intergenic
973334971 4:48946982-48947004 GAAAATGGACTAATACAGTTGGG - Intergenic
973724338 4:53758550-53758572 GAAAATAAACAAGTAAACATCGG + Intronic
974034698 4:56807694-56807716 GAAAATTGAAAAATACAGACCGG - Intergenic
974223997 4:59015184-59015206 GAAAATCAACAAAGAAACATAGG - Intergenic
974285534 4:59861872-59861894 GAAAATCAACAAAGAAATATTGG - Intergenic
974352619 4:60769825-60769847 GAAAATCAACAAAGAAACATTGG - Intergenic
974511294 4:62845358-62845380 GAAAATGGACTAATACAGATTGG - Intergenic
974735455 4:65925605-65925627 GGAAATGAATAAATACTGAGAGG - Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975335740 4:73173395-73173417 GAAAATCAACAAAGAAACATTGG + Intronic
975504180 4:75120044-75120066 GAAAATCAACAAAGAAACATTGG + Intergenic
975548227 4:75582794-75582816 GAAAATGAAACATTACATATAGG + Intronic
975665249 4:76728563-76728585 GAGAATGAACTAATACATGTGGG + Intronic
975671910 4:76788337-76788359 GAAAATTAACAAAGAAACATTGG + Intergenic
975674981 4:76818293-76818315 GAAAATGAACCAAGAAACATTGG - Intergenic
975805931 4:78112273-78112295 ATAAATCAACAAATACATATTGG + Intronic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
975919787 4:79371406-79371428 GAAAATGAACTAATACAGTTGGG - Intergenic
976029770 4:80738271-80738293 GAAAATCAACAAAGAAACATTGG - Intronic
976217748 4:82730877-82730899 GAAGACGAAAAAATACAGCTGGG - Intronic
976280410 4:83321261-83321283 GAAAATAGAAAAAGACAGATGGG - Intronic
976548421 4:86365000-86365022 AAAAAAGAACAGATACATATTGG + Intronic
976841187 4:89433908-89433930 AAAAATGAAGATATACAGAGAGG + Intergenic
976892671 4:90069033-90069055 GAAAATGAACTAATACAGTATGG + Intergenic
976943502 4:90736246-90736268 GAAAATCAACAAAGAAACATTGG - Intronic
976984619 4:91278215-91278237 GAAAATCAACAAAGAAACATTGG - Intronic
977447777 4:97153059-97153081 GAAAAAGAAAAAAAAAAGATGGG + Intergenic
977729586 4:100334670-100334692 GAAAATGAACAAAGATATTTAGG + Intergenic
977845167 4:101759436-101759458 GAAATTGAATAGAAACAGATGGG + Intronic
977854997 4:101878556-101878578 GAAAATGAACAAAGAAGCATTGG + Intronic
978032857 4:103957350-103957372 GAAAATGGACTAACACAGAAGGG - Intergenic
978112680 4:104981566-104981588 GAAAATCAACAAAGAAACATTGG + Intergenic
978339329 4:107705574-107705596 GAAAACGAACTAATACAGACTGG + Intronic
978396026 4:108281074-108281096 GAAAATGGACTAATACACATTGG - Intergenic
978547207 4:109883725-109883747 GAAAATGTACATATACATAACGG + Intergenic
979028559 4:115608900-115608922 AATAATCAACAAATACATATTGG - Intergenic
979138361 4:117140018-117140040 GAAATTGAAAAAATACAAAAAGG + Intergenic
979143351 4:117206651-117206673 TAAAATGACAAACTACAGATTGG + Intergenic
979158089 4:117423531-117423553 GAAAATGTACATATACACAATGG - Intergenic
979404307 4:120290403-120290425 GAAAATTAAAAAATAAATATTGG + Intergenic
979410515 4:120373019-120373041 GAAAATGAACAAATATAGTTGGG - Intergenic
979602014 4:122596089-122596111 TAAAATCAACAAATCCAGACTGG - Intergenic
979957523 4:126972894-126972916 CAAACTAAACAAATATAGATGGG + Intergenic
980318798 4:131240906-131240928 CTATATGAATAAATACAGATAGG + Intergenic
980461561 4:133121660-133121682 GAAAATGAGCAAATTAAGACTGG + Intergenic
980529446 4:134032908-134032930 ACAAATGAACAAATACTGACTGG + Intergenic
980568604 4:134579933-134579955 GAAAAAGAAAAAAAACAGTTAGG - Intergenic
981080961 4:140638627-140638649 AAAAATAAAAAAATAAAGATTGG + Intronic
981106622 4:140889052-140889074 TTAAATGAAAAAATAGAGATGGG + Intronic
981142769 4:141289348-141289370 GAAAATTAACAAAGAAACATTGG - Intergenic
981694791 4:147549418-147549440 GAAAACGGACTAATACATATGGG + Intergenic
981695398 4:147554025-147554047 GAAAATGGACTAATACAATTGGG + Intergenic
981986793 4:150866760-150866782 GAAAATGAACAAAACTATATGGG + Intronic
982332536 4:154197065-154197087 AAAAATGGACTAATACAGAAAGG + Intergenic
982767591 4:159366202-159366224 AAAAATAACCAAATATAGATAGG + Intergenic
982797253 4:159661257-159661279 GAAAATGGACTAATACAGGCAGG - Intergenic
982829390 4:160042175-160042197 GAAAATGAACTAATACACCAGGG - Intergenic
982851485 4:160321900-160321922 GAAAATGAGAAAAAACACATAGG + Intergenic
982855573 4:160378208-160378230 GAAAATCCTCAAATACAGACAGG - Intergenic
983214398 4:164989773-164989795 GAAAATGTATAAGCACAGATGGG + Intergenic
983367675 4:166815204-166815226 GAAAATTCCCAAATACAGAAAGG - Intronic
983450416 4:167903401-167903423 GAGAATGAACACAAACACATAGG - Intergenic
983543084 4:168933613-168933635 GAAAATCAACAAAGAAACATTGG + Intronic
983670332 4:170229977-170229999 GAAACTGACCAAAAACAGAAAGG - Intergenic
983771895 4:171561229-171561251 GAAAATGAACTAAGACAGGGAGG - Intergenic
983772537 4:171569721-171569743 GAAAATGGACTAATACACTTGGG - Intergenic
983840425 4:172450933-172450955 ATAAATGAATAAATACAGAAAGG - Intronic
983869407 4:172807799-172807821 ACAAACAAACAAATACAGATGGG - Intronic
983892871 4:173048820-173048842 GAAAATCAACAAAAACACACAGG - Intergenic
983925234 4:173393658-173393680 GAAAATCAACAAAGAAAGAGTGG - Intronic
984055057 4:174918057-174918079 AAAAGGGAACAAATACAAATGGG + Intronic
984068481 4:175081367-175081389 GAAAATAAACAAAGAAACATTGG - Intergenic
984701897 4:182823823-182823845 GAGAATGAACAAGGACAGCTTGG - Intergenic
985140581 4:186836237-186836259 TAAAATGAACAAATAAAAGTAGG + Intergenic
985229852 4:187802947-187802969 GAAAATCAACAAAGAAACATAGG + Intergenic
985340203 4:188943049-188943071 GAGAATGGACTAATACAGAAAGG + Intergenic
985394505 4:189527753-189527775 GAGAATGAACTAATACAGTGGGG - Intergenic
985975000 5:3411732-3411754 GAAAATGAAGAAGTAGATATTGG + Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986085053 5:4436794-4436816 GAAAATGGACTAATACAAAAGGG - Intergenic
986185462 5:5431924-5431946 GAAAATAAATAAAAACAAATAGG - Intronic
986406188 5:7427264-7427286 GAGAATGAACTAATACAGGTGGG - Intronic
986615084 5:9607750-9607772 GAAAATGGGCAAATATAAATAGG - Intergenic
986657010 5:10023545-10023567 GAAAGTGAACAAAGAAATATTGG + Intergenic
986798265 5:11233146-11233168 GAGAATGGACTAATACAGAGGGG + Intronic
986911327 5:12561640-12561662 GAAATGGAAGACATACAGATTGG - Intergenic
987260670 5:16199004-16199026 GAAAATTAACAAAAACATTTAGG + Intergenic
987261907 5:16212888-16212910 GAAAATGGACTAATACAGAGTGG - Intergenic
987326767 5:16819467-16819489 GTAAATGAGTAAATACAGAGTGG - Intronic
987461299 5:18214458-18214480 GAGAATGAACTAATACACAGCGG - Intergenic
987612043 5:20218117-20218139 GAAAATCAACAAAGAAACATTGG + Intronic
987748897 5:22013928-22013950 AAAAATGAACAAATAGAGGCTGG + Intronic
987909261 5:24121298-24121320 GAAAATGGACGAATACACAGAGG - Intronic
987978906 5:25054234-25054256 GAAAATAAACAAATAAGGCTGGG + Intergenic
988159500 5:27501946-27501968 GAAAATGGACTAATACAGTTGGG - Intergenic
988200268 5:28059638-28059660 GAAAATTAACTAATAAACATAGG + Intergenic
988205784 5:28131768-28131790 GTAAAGGAAAAAATACATATAGG + Intergenic
988289417 5:29266648-29266670 GAGAATGGACTAATACAGATAGG - Intergenic
988349038 5:30076552-30076574 AAAAACAAACTAATACAGATAGG + Intergenic
988353809 5:30146361-30146383 GAAAATCAACAAAGAAACATCGG - Intergenic
988644315 5:33077510-33077532 GAAAACGAACTAATACAGTTAGG + Intergenic
988701460 5:33679275-33679297 GAAAATGGACTAATACAGGAAGG - Intronic
988924720 5:35978320-35978342 GAAAATGGACTAATACAGAGTGG - Intronic
988955990 5:36320152-36320174 GAAAATCAACAAAGAAACATTGG - Intergenic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989532861 5:42527655-42527677 GAAAATTAACAAAGACATTTAGG + Intronic
989640691 5:43580256-43580278 GAAAATGATCAACAACAAATGGG + Intergenic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
989827780 5:45879746-45879768 GAAAACGAACTAATACAGTCTGG + Intergenic
990095945 5:52113100-52113122 GAAAATCAACAAAGAAACATTGG - Intergenic
990126953 5:52530986-52531008 ATAAAGGAAAAAATACAGATAGG + Intergenic
990185754 5:53207127-53207149 GAAAATTGACAAATACACAGAGG + Intergenic
990229420 5:53695566-53695588 AAAAATGGACTAATACAAATAGG + Intergenic
990336652 5:54779227-54779249 GAAAATGAACTAATACAGAGGGG + Intergenic
990480364 5:56204713-56204735 GAGAATGGACTAATACAGGTAGG + Intronic
990498345 5:56370640-56370662 GAGAAAGAACAAATACACAAGGG + Intergenic
990524817 5:56614635-56614657 GAAATGGGACAAATACAAATAGG - Intergenic
990593210 5:57286858-57286880 GAAAATCAACAAACAAACATTGG + Intergenic
991119934 5:63000950-63000972 GCTAAAGAACTAATACAGATGGG - Intergenic
991195297 5:63924979-63925001 GAAAATGGACTAATACATGTGGG + Intergenic
991259590 5:64652638-64652660 GAAAATGGACTAATACAGAGGGG - Intergenic
991275388 5:64841043-64841065 GAAAATGGACAAAGATAGACAGG - Intronic
991293494 5:65057117-65057139 GAAAATCAACAAAGAAACATTGG - Intergenic
991605979 5:68401600-68401622 GAGAATGGACTAATACAGTTTGG - Intergenic
991685480 5:69178436-69178458 TATAATGCACAAATACAGGTAGG - Intergenic
991693391 5:69247138-69247160 GAAAACCAACAAAGACACATTGG - Intronic
991769082 5:70023696-70023718 AAAAATGAACAAATAGAGGCTGG + Intergenic
991848377 5:70899114-70899136 AAAAATGAACAAATAGAGGCTGG + Intergenic
992516350 5:77497298-77497320 GAAAATGAAAACCTACAGAATGG + Intronic
992660136 5:78951205-78951227 TAAAATAAAAAAATAAAGATAGG - Intronic
993046967 5:82878498-82878520 GAAAATCAACAAAGAAACATTGG - Intergenic
993118495 5:83746411-83746433 GAAAATTGACAAATACACAGAGG - Intergenic
993202783 5:84838701-84838723 GAAAATGAACTAAGATAAATAGG + Intergenic
993421996 5:87714284-87714306 AGAAATGAACAAAGACAGCTTGG + Intergenic
993569844 5:89523884-89523906 GAAAATGGACTAATACAAAGGGG - Intergenic
993580671 5:89656619-89656641 GAAAATCAACAAAGAAACATCGG + Intergenic
993623600 5:90196012-90196034 GAAAATCAACAAAGAAACATCGG + Intergenic
993704513 5:91154592-91154614 GAGAATGGACTAATACAGATAGG - Intronic
993724894 5:91355935-91355957 TAAAATGAAAAAATACAGCCTGG - Intergenic
993884160 5:93396852-93396874 GAGAATGGACTAATACAGAAGGG + Intergenic
993981864 5:94552367-94552389 GAAAATCAACAAAGAAACATTGG + Intronic
994186655 5:96822703-96822725 GAAAAGGAACTAATACAAATGGG - Intronic
994341089 5:98628641-98628663 GAAAATGAAAATAGACAAATAGG + Intergenic
994512139 5:100717934-100717956 GAAAATTAAGAAATACTAATAGG - Intergenic
994641611 5:102417395-102417417 AAAAGTGAACAAAAAGAGATAGG - Intronic
994866364 5:105276867-105276889 GAAAATGGACTAATACATACTGG + Intergenic
994920360 5:106034976-106034998 GAGAATGGACTAATACAGAGGGG - Intergenic
995262450 5:110121149-110121171 GAAAATCAACAAAGAAACATTGG - Intergenic
995304593 5:110630747-110630769 GAGAATGAACTAATACAGAAGGG + Intronic
995318165 5:110800139-110800161 GAAAATGGACTAATACAGAGAGG - Intergenic
995357690 5:111258349-111258371 GAAAACAAACTAATACAAATAGG - Intronic
995432763 5:112100083-112100105 GAAAATGAGAAGATACAAATGGG - Intergenic
995598182 5:113768907-113768929 GAAAATGAACTAATATAGGTAGG + Intergenic
995955947 5:117776343-117776365 GAAAAAAAACAACTACAAATAGG + Intergenic
996055711 5:118980027-118980049 GAAAATGAAGAAATGAACATTGG - Intronic
996223152 5:120957681-120957703 GAAAATCAACAAAGAAATATTGG - Intergenic
996515895 5:124368976-124368998 GAAAATGGACTAAAACAGTTGGG - Intergenic
996603721 5:125296253-125296275 GAAAAAAAAAAAAAACAGATAGG + Intergenic
996821589 5:127635236-127635258 GAATATGACCAAATACAAAATGG + Intergenic
996908435 5:128629670-128629692 GAGAATGAACTAATACAGAGGGG - Intronic
997184018 5:131863333-131863355 GAAAATCAACACATAAACATTGG - Intronic
997269532 5:132525246-132525268 GAGAATGAACTAATACACATGGG + Intergenic
997652151 5:135530417-135530439 GAAAACTGACTAATACAGATGGG - Intergenic
998661460 5:144243468-144243490 CAACATAAACAAATACACATGGG - Intronic
998677341 5:144424537-144424559 GAAAATGATCGAAGACAGAGTGG - Intronic
998925565 5:147120996-147121018 GAAAATCAACAAAGAAACATTGG - Intergenic
999406040 5:151307967-151307989 GAAAATTAACAAAGAAACATAGG - Intergenic
999571779 5:152926845-152926867 GAGAATGAACTAATGCAGAGAGG + Intergenic
999772334 5:154785102-154785124 TAAAATGAGGAAAGACAGATGGG - Intronic
1000222437 5:159226969-159226991 GGAAATGAACTAATACAGGGAGG - Intergenic
1000359440 5:160433588-160433610 TTAAATGAACACATAAAGATAGG - Intergenic
1000445640 5:161315434-161315456 GAAAATGAAAAAAGACACCTAGG - Intronic
1000475214 5:161698420-161698442 GACAAAGAAGAAATAAAGATAGG + Intronic
1000800310 5:165718683-165718705 GAGAACAAACTAATACAGATAGG - Intergenic
1000876683 5:166647949-166647971 CTAAATGAACCAATACAGCTAGG + Intergenic
1001244500 5:170095838-170095860 GAAAAAGGACAATGACAGATGGG + Intergenic
1001346927 5:170911453-170911475 GAAAATGATCATAAACAGAGTGG - Intronic
1001609765 5:172990837-172990859 AAAAAAAAAAAAATACAGATGGG + Intronic
1001627579 5:173149181-173149203 GAAAACAGACTAATACAGATGGG - Intronic
1002039734 5:176504000-176504022 GAAAATACAAAAATACAGAATGG + Intronic
1002839377 6:892909-892931 GAACATGAACAAACGCTGATGGG + Intergenic
1003818327 6:9866507-9866529 GAAAATGGACTAATACAAATGGG + Intronic
1004385956 6:15172902-15172924 TAAAATTAAAAAATACAGCTGGG + Intergenic
1004689920 6:17984578-17984600 GAAAAAAAAAAAAAACAGATGGG - Intronic
1004698762 6:18058911-18058933 GAAGGTGAAGAAATACAGAGGGG + Intergenic
1004738769 6:18435403-18435425 AAAAATGAATAAATAGAGAAGGG + Intronic
1004761143 6:18667734-18667756 GAAAAGGAACAAAGACAGAGAGG - Intergenic
1004782526 6:18926593-18926615 GAAAATCAACAAAGACACATTGG - Intergenic
1004847999 6:19667013-19667035 GAAAAAAAACAAATACAAAAAGG + Intergenic
1004862120 6:19815158-19815180 GAAAATACACAAATAGAGATTGG + Intergenic
1005100846 6:22171508-22171530 GATGATGACCACATACAGATGGG + Intergenic
1005956587 6:30668353-30668375 GAAAAAGAAAAATTACAGCTGGG + Intronic
1006018282 6:31100465-31100487 GAAAATGTACATATACATAATGG - Intergenic
1006170751 6:32090821-32090843 GAAAATGAACAAATAAATTCTGG - Intronic
1006272664 6:32976190-32976212 GCAAATGGACAACTAAAGATGGG + Intronic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1007289304 6:40773203-40773225 GAAAACAAACTAATACAGAGGGG - Intergenic
1007362076 6:41365915-41365937 GAAAATGTACATATACACAATGG - Intergenic
1007884747 6:45214430-45214452 AAAAATGAAAAAATACAGAAAGG + Intronic
1007948313 6:45846168-45846190 GAAAATGAACAAAAACAAGCTGG + Intergenic
1007997422 6:46322937-46322959 GAAAATGAACAAATTAAGGTGGG - Intronic
1008025775 6:46634392-46634414 GAAAACGGACTAATACAAATAGG + Intronic
1008048866 6:46879644-46879666 AAAAATGGACTAATACATATCGG + Intronic
1008142181 6:47844673-47844695 AAGAATGAACAAAAAGAGATGGG - Intergenic
1008245662 6:49169433-49169455 GAAAATCAACAAAGATACATTGG - Intergenic
1008347604 6:50447721-50447743 AAAATTGAACAAATATAGTTTGG - Intergenic
1008777529 6:55059412-55059434 GAAAATTAACAAAGAAACATTGG - Intergenic
1008981936 6:57493820-57493842 GAAAAGGAACAAAAACCCATAGG - Intronic
1009039134 6:58156406-58156428 GAAAATCAACAAAGAAATATTGG - Intergenic
1009215027 6:60911247-60911269 GAAAATCAACAAAGAAATATCGG - Intergenic
1009688951 6:67001536-67001558 GAAATACAACATATACAGATTGG + Intergenic
1009710100 6:67307390-67307412 GAGAATCAACTAATACAGTTAGG + Intergenic
1009825207 6:68858135-68858157 GAAAATGGACTAATACAGTCAGG + Intronic
1009978214 6:70696784-70696806 GAAAATTAACAAAGAAACATTGG - Intronic
1010176559 6:73034295-73034317 AAAAAGGAACAAAAACAGCTGGG + Intronic
1010607900 6:77914615-77914637 GAAAATCAACAAAGAAACATTGG - Intronic
1010986574 6:82432129-82432151 GAAAATGTACATAAACTGATTGG - Intergenic
1011046325 6:83087387-83087409 GAAAATGAGCAACTAAACATTGG - Intronic
1011111747 6:83845218-83845240 GAAAATAAACAAATACATTAAGG - Intergenic
1011236794 6:85227401-85227423 GAAAATGGACTACTACAGTTAGG - Intergenic
1011296969 6:85836634-85836656 GAAAATCAACAAAAAAATATTGG + Intergenic
1011426540 6:87238144-87238166 GTATATGAAAAAATACACATAGG + Intronic
1012107863 6:95188475-95188497 TAAAATGAACAAAGTAAGATAGG - Intergenic
1012147502 6:95703930-95703952 GAAAACGAACTAATACAGAGTGG - Intergenic
1012161766 6:95893840-95893862 GAAAAAGAAAAACTACAGAAGGG - Intergenic
1012188771 6:96255010-96255032 GAAAATGGACTAATACAATTAGG - Intergenic
1012220894 6:96648007-96648029 GAAAATAAACAAAGACAAAAAGG + Intergenic
1012638837 6:101582597-101582619 GAGAATGGACTAATACAGATGGG + Intronic
1012690354 6:102303063-102303085 GAAAATCAACAAAGAAACATTGG + Intergenic
1012713308 6:102636363-102636385 GAAATTCAACAAAGACACATTGG + Intergenic
1012987539 6:105890923-105890945 GAAAACAGACAAAGACAGATTGG + Intergenic
1013384038 6:109606407-109606429 AGAAATGAACAAGAACAGATAGG + Intronic
1013502522 6:110766837-110766859 GAAAATAAACAAATAAGGCTGGG + Intronic
1013753143 6:113430278-113430300 GCATATTAACAAATACAGAGGGG - Intergenic
1014073659 6:117212476-117212498 GAAAATCAACAAAGAAACATTGG - Intergenic
1014248375 6:119091874-119091896 GAGAATGAGCCAATACAGTTGGG + Intronic
1014309047 6:119776193-119776215 GAGAATGAACAAATAATTATTGG - Intergenic
1014542154 6:122689794-122689816 GAAAATCAACAAAGAAACATTGG - Intronic
1014697057 6:124635891-124635913 GAAAATCAACAAAGAAACATTGG + Intronic
1014918532 6:127183814-127183836 GAGAATGCACTAATACAGGTGGG - Intronic
1014961081 6:127686016-127686038 GATAAAAAACAAAAACAGATTGG + Intergenic
1015052593 6:128860548-128860570 GAAAATAAACAAAGAAACATTGG - Intergenic
1015234973 6:130960439-130960461 GACAAAGTACAAATACAGACAGG + Intronic
1015365770 6:132395990-132396012 GAAAATTAACAAAGAAACATTGG + Intronic
1015792044 6:136973588-136973610 GAAAAGAAACAGATACAGAGAGG - Intergenic
1015827948 6:137335620-137335642 GAAAATGAAAAAAGACAAAAGGG - Intergenic
1015907829 6:138135953-138135975 CAAAATGGACCAATACAGAATGG + Intergenic
1015911779 6:138175785-138175807 GAAAATCAACAAAGAGACATTGG - Intronic
1016061221 6:139633014-139633036 AAAAATCAACAAATAAACATTGG - Intergenic
1016064869 6:139670779-139670801 GAAAATCAACAAAGAAAAATTGG + Intergenic
1016090875 6:139977287-139977309 CTAGATGAACAAATAAAGATAGG - Intergenic
1016103404 6:140131066-140131088 GAAAATCAACAAAGAAATATTGG + Intergenic
1016129686 6:140451832-140451854 GAAAATAAAACCATACAGATTGG - Intergenic
1016136608 6:140551858-140551880 GAAAATCAACAAAGAAAGATTGG - Intergenic
1016580112 6:145619926-145619948 AAAAATGAACAAATGCAAACAGG + Intronic
1016664386 6:146618890-146618912 GAAAATCAACAAAGAAACATTGG - Intronic
1016855401 6:148665377-148665399 GAAAATCAACAAAGAAAGAGTGG - Intergenic
1017097683 6:150819262-150819284 GAAAAAGAATAAATCCATATAGG + Intronic
1017209686 6:151841270-151841292 GAATAGGAAAAGATACAGATAGG - Intronic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1017473982 6:154769768-154769790 AAAAATAAACAAATACATATAGG - Intronic
1017524353 6:155229694-155229716 GAAAATGAATTAATACACCTGGG - Intronic
1017631850 6:156403624-156403646 GAGAACGGACTAATACAGATGGG + Intergenic
1017763474 6:157588974-157588996 GAAAATAGACTAATACAGATGGG - Intronic
1017798352 6:157868777-157868799 GAGAAGGAACAAAAGCAGATAGG + Intronic
1018071455 6:160167804-160167826 GAGAATGAATGAATACAGCTGGG + Intergenic
1018078489 6:160238087-160238109 GAAAGTAAACAAATAAAGAATGG - Intronic
1018182389 6:161235510-161235532 GAGAATGGACTAATCCAGATGGG - Intronic
1018473886 6:164121764-164121786 AAAAATGGACTAATACAGCTGGG - Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1018614399 6:165672808-165672830 GAAAACGGACTAACACAGATGGG + Intronic
1018675307 6:166216262-166216284 GAAAAGGAAGCTATACAGATAGG + Intergenic
1019699062 7:2464208-2464230 TAAAATAAATCAATACAGATTGG - Intergenic
1019882100 7:3870707-3870729 CAAAATGAACAAATTAACATTGG + Intronic
1019896767 7:3989102-3989124 GAAAACCGACTAATACAGATAGG - Intronic
1020060705 7:5149678-5149700 GAGAATGAACTAATACAAAGGGG + Intergenic
1020104982 7:5418647-5418669 AAAAATAAACAAATAAAGATGGG + Intronic
1020167637 7:5820573-5820595 GAGAATGAACTAATACAAACGGG - Intergenic
1020345234 7:7154989-7155011 GAAAATGGACTAATACACATGGG + Intergenic
1020389875 7:7646653-7646675 GAAAATGAACTAATACAGATGGG + Intronic
1020519017 7:9163257-9163279 GAAAATCAACAAAGACACATTGG - Intergenic
1020706516 7:11550718-11550740 GAAAATGAACTAATTCAGATAGG + Intronic
1020765280 7:12311864-12311886 GAAAAGGAAAAAATACAGACAGG - Intergenic
1021019960 7:15585299-15585321 GAGAATGGACAAATACAAAAGGG + Intergenic
1021035188 7:15789219-15789241 GAAAATCAACAAAGAAACATGGG + Intergenic
1021150114 7:17140341-17140363 TAAATTGAAAAAATGCAGATGGG + Intergenic
1021287167 7:18794634-18794656 GAAAATGAGCAAATAAAAAGAGG + Intronic
1021318749 7:19184782-19184804 GAAAATCAACAAAGAAACATTGG + Intergenic
1021424067 7:20479083-20479105 GAACATGAACAAAGACACAGAGG + Intergenic
1021801438 7:24310749-24310771 GAAAAGGAAAAAACACATATAGG + Intergenic
1022313502 7:29220352-29220374 GAAAATTAACAAAAACAACTGGG + Intronic
1022549882 7:31228438-31228460 GAAAACAAACTAATACAGTTGGG + Intergenic
1022592076 7:31673133-31673155 GAAAATGGACTAATACAGTGGGG + Intergenic
1022715859 7:32897671-32897693 GAAAAGTAACTAAAACAGATAGG - Intergenic
1022875668 7:34526253-34526275 GAAAATCAACAAAGAAACATTGG - Intergenic
1022982627 7:35618682-35618704 GAAAATGGACTAATACAGAGTGG + Intergenic
1023199151 7:37674976-37674998 GAAGATGAACAACTAGAGACTGG + Intergenic
1023200381 7:37690854-37690876 GAAAATAAACAAAGAAATATTGG - Intronic
1023883050 7:44332209-44332231 TAAAATAAAGAAATAAAGATTGG + Intronic
1023911201 7:44558258-44558280 CAAAAAGAAAAAAGACAGATAGG - Intergenic
1024191198 7:47012203-47012225 AAAAATAAAGACATACAGATTGG + Intergenic
1024368805 7:48556343-48556365 GAAAATCAACAAAGAAACATTGG - Intronic
1024433333 7:49317487-49317509 GACAAGGGAAAAATACAGATTGG + Intergenic
1024483583 7:49890958-49890980 TAAAAGGAACAAAAAAAGATGGG + Intronic
1024656177 7:51453063-51453085 GAAATTGAACAAACACATTTAGG + Intergenic
1025034396 7:55584429-55584451 AAAAAGGAAAAATTACAGATGGG - Intergenic
1025061098 7:55809043-55809065 GAAAATGAACATATACACTATGG + Intronic
1025160712 7:56657974-56657996 TAAAATCAACAAATAAACATTGG + Intergenic
1025655669 7:63516409-63516431 AAGAATGAACAAAGGCAGATTGG + Intergenic
1025726019 7:64061212-64061234 TAAAATCAACAAATAAACATTGG - Intronic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026454873 7:70562221-70562243 CAAAATGGACAAATACACATGGG + Intronic
1026619412 7:71937061-71937083 GAAAATGGACTAATACAATTAGG + Intronic
1026655986 7:72256957-72256979 GAAAATGAACTAATACAGTGGGG - Intronic
1027463438 7:78484603-78484625 GGAAATGAACAAATCCATATAGG - Intronic
1027937996 7:84633395-84633417 GAAAACGAACTAATACAGTTGGG + Intergenic
1027984333 7:85267057-85267079 GAAAATGTACAAAGAAACATTGG + Intergenic
1028011218 7:85647725-85647747 GAAAATGAAATAATACAGTGAGG - Intergenic
1028161269 7:87487769-87487791 GAAAATTAACAAAGAAACATTGG + Intergenic
1028265603 7:88720161-88720183 ACAAAGGAACAAAAACAGATGGG - Intergenic
1028435663 7:90800553-90800575 GAAAAACAACAAAAACAGATAGG - Intronic
1028445003 7:90912058-90912080 GAAAATGAACATATTCAAACTGG + Intronic
1028473393 7:91228475-91228497 AAAAATAAACAAATAAAGCTGGG - Intergenic
1028547618 7:92021245-92021267 GAAAATAAACAATTAGAGAACGG - Intronic
1028761371 7:94500456-94500478 GTAACTGAATAAATACAAATTGG + Intergenic
1028831876 7:95337422-95337444 GAGAATGGACTAATACAGCTGGG - Intergenic
1028869539 7:95753631-95753653 GAAAATCAATAAATAAACATTGG - Intergenic
1028959437 7:96732448-96732470 GAAAAGAAACAAATAAAGGTAGG - Intergenic
1028972956 7:96879308-96879330 GAAAATCAACAAAGAAATATGGG + Intergenic
1029441988 7:100591932-100591954 GAAAATGGACTAATACAGGTGGG - Intronic
1029591294 7:101508805-101508827 CAAAACGAACTAATACAGGTGGG - Intronic
1029592618 7:101517312-101517334 GAAAACGGACCAATACAGATGGG - Intronic
1029814309 7:103077321-103077343 GAAAATGGACTAATACAGTAAGG - Intronic
1030249834 7:107429936-107429958 GAAAACGGACTAATACAGTTGGG + Intronic
1030332836 7:108291013-108291035 GAAAATGAACAAAACCACTTGGG + Intronic
1030431186 7:109451584-109451606 GAAAATCAACAAAGAAACATTGG - Intergenic
1030535647 7:110763092-110763114 GAAAATGAAGAAATCCACATTGG + Intronic
1030787016 7:113674828-113674850 GAAAATGGACTAATACACAGGGG - Intergenic
1030803630 7:113886547-113886569 GAAAATAGACTAATACAGGTGGG + Intronic
1031002018 7:116426682-116426704 TAAAGTAAATAAATACAGATGGG + Intronic
1031098755 7:117451920-117451942 GAAAATCAACAAAGAAACATTGG + Intergenic
1031194780 7:118599474-118599496 TAAAAAGAACAATTACAGAAGGG + Intergenic
1031230376 7:119098011-119098033 GAAAATGTATATATACAAATTGG - Intergenic
1031320080 7:120314020-120314042 AAAAATCAACAAATACAGTAAGG + Intronic
1031432051 7:121683991-121684013 GAAAATAGACTAATACAGAAGGG - Intergenic
1031480049 7:122267371-122267393 GAAAATGAACTAATACAGATGGG + Intergenic
1031532312 7:122889521-122889543 GAAAATGGGGAAATACAGAAGGG + Intergenic
1031553253 7:123141450-123141472 GAAAATCAACAAAGAAACATTGG - Intronic
1031606518 7:123774637-123774659 GGAAATGAAAAAATACTGAAGGG - Intergenic
1031623248 7:123961699-123961721 GAAAATGGACTAATACACATAGG - Intronic
1031642581 7:124182667-124182689 GAAAATAAACTAAAACAGAATGG + Intergenic
1031659569 7:124404742-124404764 AAAAAAGATCAAATAAAGATAGG - Intergenic
1031710277 7:125036046-125036068 GAAAATAAAGAAAAACACATAGG + Intergenic
1031721221 7:125179407-125179429 CAAAATGAACAATTAAAAATTGG - Intergenic
1031722197 7:125190329-125190351 GAAAATCAACAAAGAAACATTGG + Intergenic
1031785378 7:126024351-126024373 GAAAATGGACTAATACAGGCTGG + Intergenic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032234859 7:130111808-130111830 CAAAAAGAAGAAATACAAATGGG + Intronic
1032341297 7:131075700-131075722 GAAAATGGACTAAAACAGAGAGG - Intergenic
1032738947 7:134719665-134719687 CAAAATGGACAAACACATATCGG - Intergenic
1032865678 7:135921748-135921770 GACCATGAACAAATACAAAGAGG - Intergenic
1032901799 7:136318361-136318383 GCAAATGAACAAAGAAATATTGG - Intergenic
1033027042 7:137784573-137784595 GAAAATGAACAAAGAAACAATGG + Intronic
1033040418 7:137912473-137912495 GAACATGACCAAATAGAGAGGGG + Intronic
1033091358 7:138389126-138389148 AAAAATGATCAAAGACAGCTTGG + Intergenic
1033103326 7:138496407-138496429 AAAAATAAATAAATCCAGATTGG - Intronic
1033257678 7:139816283-139816305 GAAAATCGGCTAATACAGATGGG + Intronic
1033280133 7:140000497-140000519 GAAAATAAACAAACACATATTGG + Intronic
1033304941 7:140218445-140218467 GAAAATGGACTAATACCGAAGGG + Intergenic
1033487635 7:141806403-141806425 GAGAATGGACTAATACAGAGGGG + Intergenic
1033496059 7:141897447-141897469 GAAAAAGAATAGATACAAATAGG + Intergenic
1033913712 7:146297411-146297433 GAAAAGGAAGAAATATAGATGGG + Intronic
1034230105 7:149517581-149517603 GAAAATCAACAAAGAAACATTGG + Intergenic
1034683745 7:152951486-152951508 GAGAATGGACTAATACACATGGG + Intergenic
1034882034 7:154770119-154770141 GAAAATAGACAAATACATAAGGG - Intronic
1035106677 7:156446830-156446852 GAAAATGGACCAAGACAGGTGGG - Intergenic
1035371159 7:158379756-158379778 GAAAAAGGACTAATACAGCTAGG - Intronic
1035405673 7:158595564-158595586 GAGAACGAACTAATACAGGTAGG - Intergenic
1035840625 8:2809122-2809144 GAAAATGGATGAATACAGACAGG - Intergenic
1036087375 8:5626895-5626917 GAAAATGGACTAATACAGAGGGG + Intergenic
1036506587 8:9362223-9362245 CAAAATGAAGAAATAAAAATTGG + Intergenic
1036605055 8:10297242-10297264 GAAGATGAACAAATGGAGAGGGG - Intronic
1036726126 8:11222874-11222896 GAGAATGGACTAATACAGAGAGG - Intergenic
1037461091 8:19110055-19110077 AAAAATGAAAAAATACAGCCAGG - Intergenic
1037672298 8:21025546-21025568 GACAATGAACAAATAAACAAAGG + Intergenic
1037731689 8:21530892-21530914 GAAAACAAAAAAATACAGACTGG + Intergenic
1037852673 8:22345358-22345380 GAAATTGAAATAATACAAATGGG + Intronic
1038093528 8:24281689-24281711 AAAAATTAAGAAATACAGAGAGG + Intergenic
1038161669 8:25045445-25045467 GAAAATCAACAAATGGAAATGGG + Intergenic
1038218911 8:25588886-25588908 AATAATAAACAAATAAAGATTGG - Intergenic
1038376291 8:27043181-27043203 GAAAAGGAACAAAAGCAGAGGGG - Intergenic
1038522461 8:28244911-28244933 GAAAATAGACTAATACAGATGGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1038855630 8:31328663-31328685 TAAAATTAAAAAATAAAGATAGG + Intergenic
1038860536 8:31383613-31383635 GAAAATCAACAAAGAAAAATTGG + Intergenic
1039072530 8:33659850-33659872 GAAAATGAACTAATACATGTGGG + Intergenic
1039336777 8:36600059-36600081 AAAAGTGAATAAATCCAGATTGG - Intergenic
1039608803 8:38902789-38902811 GAAAAAGAAAAAATAAAGACAGG - Intronic
1039632531 8:39128062-39128084 GAAAATTAACAAAGATATATGGG - Intronic
1040448601 8:47521720-47521742 GAAAATAAAAAAATAAAGAGTGG - Intronic
1040577578 8:48667255-48667277 GAAAATGAACTAATACAGCCAGG - Intergenic
1040852643 8:51917048-51917070 GGAAATAAAGACATACAGATTGG - Intergenic
1041297225 8:56370150-56370172 AAAAATCAACAAGGACAGATTGG - Intergenic
1041384361 8:57283024-57283046 AAAAATGAATAAATACAGTTGGG - Intergenic
1041739444 8:61142429-61142451 GAAAATGGACTAATACAATTGGG + Intronic
1041996298 8:64063023-64063045 GAAAATCAACAAAGAAACATTGG + Intergenic
1042306479 8:67338683-67338705 AGAAAAGAACAAATACAAATAGG + Intronic
1042631352 8:70820527-70820549 GAAAATGAACTAATACAAGCTGG - Intergenic
1042859634 8:73299199-73299221 GGAAATCACCAAATACAGTTTGG + Intronic
1042901205 8:73729909-73729931 GACAAAGAAAAAACACAGATAGG - Intronic
1042923351 8:73941298-73941320 GAAAATGGACTAATACAGAGAGG + Intronic
1043116290 8:76257696-76257718 GAAAATTAACAAAGAAATATTGG + Intergenic
1043133800 8:76495559-76495581 GAAAATCAACAAAGAAACATTGG - Intergenic
1043302946 8:78757427-78757449 GAAAATCAACAAAGAAATATTGG - Intronic
1043321331 8:78990325-78990347 GAATCTGGACAAATACAGACAGG - Intergenic
1043360112 8:79462007-79462029 GACAATGGACTAATAGAGATGGG + Intergenic
1043551941 8:81384206-81384228 GAAAATAAACAAAGAAACATTGG - Intergenic
1043600513 8:81931474-81931496 GAAAATCAACAAAGAAACATCGG + Intergenic
1043945441 8:86246168-86246190 GAAAATGTACATATACACAAGGG - Intronic
1043985381 8:86689318-86689340 GAAAATCAACAAAGAAACATTGG - Intronic
1044025938 8:87172410-87172432 GAAAATCAACAAAGAAAGATCGG - Intronic
1044765125 8:95563563-95563585 GAAAATCAACAAAGAAATATTGG + Intergenic
1045018612 8:98021439-98021461 GCATATGCACAAATACAGAATGG + Intronic
1045066272 8:98448921-98448943 AAAAATGGAAAAATACAGAGAGG + Intronic
1045084946 8:98672116-98672138 GAGAATGAACTAACACAGACAGG + Intronic
1045627225 8:104068546-104068568 GAAAATTAACAAATACAAACAGG + Intronic
1046029841 8:108770159-108770181 GAATATGACCAAATACAGAGAGG + Intronic
1046113897 8:109762309-109762331 GAAAATCAACAAAGAAACATTGG - Intergenic
1046165760 8:110432614-110432636 GAAAATGGACTAATACAGACTGG + Intergenic
1046272595 8:111915989-111916011 GAAAATGAACTAAGACAGGAAGG - Intergenic
1046596769 8:116270540-116270562 GAAAATTAACAAAAACATTTGGG - Intergenic
1047195703 8:122719358-122719380 GAAAATGGACTAATACAGTGGGG + Intergenic
1047374242 8:124281145-124281167 GAGAATGGACTAATACAGGTGGG - Intergenic
1047419371 8:124693707-124693729 GAAAAGGGAAAATTACAGATGGG - Intronic
1047476269 8:125234291-125234313 AGAAATGAACAAATACATTTTGG + Intronic
1047519136 8:125580947-125580969 AAAAATGGACAAATACACCTTGG - Intergenic
1048128583 8:131665563-131665585 GAGAATGGACTAATACAGATTGG - Intergenic
1048478698 8:134768413-134768435 GAAAATGGACTAATACAGAGAGG - Intergenic
1048595760 8:135864016-135864038 GAAAACAAACTAATACATATAGG - Intergenic
1048723187 8:137351214-137351236 GAAAATCAACAAATAAACTTTGG - Intergenic
1048723245 8:137352133-137352155 GAAAATCAACAAAGAAATATTGG - Intergenic
1049010365 8:139883372-139883394 GAAAATGAACTAGTACAAAGAGG + Intronic
1049489461 8:142887200-142887222 GACAATGAACTAATACAAATTGG - Intronic
1049490851 8:142900979-142901001 CAAAATCAACTAAGACAGATGGG + Intronic
1049906186 9:219172-219194 GAAAAGGAACAAACAGAGCTGGG + Intronic
1050100516 9:2114236-2114258 GAAAATAATCTAATATAGATGGG + Intronic
1050208275 9:3222605-3222627 GAAACTGAAAAAATTCAGAAAGG + Exonic
1050269440 9:3926555-3926577 AGAAATGAAAAAATATAGATTGG - Intronic
1050316280 9:4404321-4404343 GGAAATCAACAAATAAACATTGG + Intergenic
1050392467 9:5159746-5159768 GAAAATCAACAAAGAAACATTGG + Intronic
1050769323 9:9177005-9177027 GAAAATGAATTAATACAAGTGGG - Intronic
1051465447 9:17371568-17371590 GAAAATCAACAAAGAAACATTGG + Intronic
1051812407 9:21065114-21065136 GAAAACAAAGAAATACAGAATGG - Intergenic
1051988312 9:23118754-23118776 GAAAATGGACTAATACAAGTAGG - Intergenic
1052078915 9:24179491-24179513 GAAAATGGACTAATACAGGCAGG - Intergenic
1052171515 9:25403458-25403480 GAAATTGAACAAATTAAGGTGGG - Intergenic
1052215189 9:25958488-25958510 GAAAATTAACAAAGAAACATTGG + Intergenic
1052267517 9:26591359-26591381 GAAAATGAACTAACACAGGAGGG - Intergenic
1052457980 9:28725386-28725408 CAAAATGATTAAACACAGATAGG + Intergenic
1052522057 9:29561630-29561652 GAAAACAAAAAAATATAGATTGG - Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052686183 9:31759764-31759786 CAAAATCAACATATACAAATTGG - Intergenic
1052695008 9:31866955-31866977 GAAAATTAACAAAGAAACATTGG - Intergenic
1052701492 9:31942505-31942527 GAAAATGGACTAATACACTTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053877519 9:42559116-42559138 GAAAATAAACAAATACATTGGGG - Intergenic
1055159035 9:73101927-73101949 GCAAATTAATAAATACACATTGG - Intergenic
1055366933 9:75554804-75554826 GAAAATGAACTAATACATATGGG - Intergenic
1055387619 9:75780282-75780304 GAAAATGTACATATACACAATGG + Intergenic
1055557710 9:77491763-77491785 GAAAATCAACAAAGAAACATGGG + Intronic
1055559445 9:77508122-77508144 GAGAATTAAGAAATACAGAGGGG - Intronic
1055563022 9:77540512-77540534 GAAAATCAACAAAGAAACATTGG - Intronic
1055653241 9:78428528-78428550 GAAAATCAACAAAGAAACATTGG - Intergenic
1055902358 9:81255941-81255963 GAATATGAAGAAAGACAGAGTGG - Intergenic
1056519922 9:87391273-87391295 GAAAAGGAAAAAATACAAACAGG - Intergenic
1056527108 9:87453947-87453969 GAAAATGTACTAATACAGAGGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056962305 9:91136364-91136386 GAAAATGGACTAATACAAGTGGG - Intergenic
1057288801 9:93785959-93785981 GAAAATCAACAAAGAAACATTGG - Intergenic
1057317983 9:93982977-93982999 GAAAATGAACTAATATATCTAGG + Intergenic
1057376544 9:94529100-94529122 GAAAGTGAACAGAACCAGATGGG - Intergenic
1057644700 9:96862040-96862062 GAAAATGTACATATACACAATGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057963094 9:99476087-99476109 GAACATGAAAAGATACAAATTGG + Intergenic
1057969125 9:99536546-99536568 GAAAATGTTCCAAGACAGATGGG + Intergenic
1058352279 9:104039869-104039891 GAAAATGAATGAATGCAGTTTGG + Intergenic
1058683793 9:107463473-107463495 AAAAATAAATAAATAGAGATGGG + Intergenic
1058736203 9:107896424-107896446 GAAAATGAACTAATACCCCTGGG + Intergenic
1059053639 9:110955513-110955535 AAAAATTAACAAATAAACATTGG + Intronic
1059059843 9:111023778-111023800 GAAAATGAACAAATTATCATAGG + Intronic
1059363523 9:113767102-113767124 GAAAATGGACTAATACAGGCTGG + Intergenic
1059587016 9:115617936-115617958 AAAAAAAAAAAAATACAGATGGG - Intergenic
1059701542 9:116779684-116779706 GAAAATGAACAGAAAAAGAAGGG - Intronic
1059739355 9:117134595-117134617 GAAAATATGCAAATACACATAGG - Intronic
1059990480 9:119860625-119860647 GAGAATGAACTAATACAAGTAGG - Intergenic
1060019728 9:120118629-120118651 AAAAATGGACTAATACAGCTGGG + Intergenic
1060507203 9:124206962-124206984 CAAAATCACCAAATACACATCGG - Intergenic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1060673908 9:125495091-125495113 GAACATGGACAAAGACATATTGG - Intronic
1060739249 9:126087364-126087386 GAAAACAAACTAAGACAGATGGG - Intergenic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1061341439 9:129984970-129984992 GAAAATGGACTAATACAATTAGG + Intronic
1061851074 9:133415991-133416013 CACAATGAACTAATACAGATGGG - Intronic
1062131765 9:134899003-134899025 GAAAAGTAACAAAGACAGATTGG + Intergenic
1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG + Intergenic
1185974285 X:4701681-4701703 GAAAATGGACAAATACACTCTGG + Intergenic
1186039987 X:5465284-5465306 GAAACTGAACAAATAGAATTGGG + Intergenic
1186051767 X:5604177-5604199 GAGAATGGACTAATACAGATGGG - Intergenic
1186094365 X:6083451-6083473 TAAAATGAACTAAGAAAGATTGG + Intronic
1186658920 X:11647893-11647915 AAAAATAAATAAAGACAGATTGG + Intronic
1187133431 X:16524971-16524993 GAAAATGGACTAATACACTTAGG - Intergenic
1187214074 X:17257952-17257974 GAAAATCAACAAAGAAACATCGG + Intergenic
1187696344 X:21924924-21924946 GCAAAAGAAAAAATACAGAGTGG - Intergenic
1188075372 X:25769730-25769752 GAAAATCAACAAAGAAACATTGG + Intergenic
1188201543 X:27298441-27298463 GACAATGAACAAATTTAAATGGG - Intergenic
1188204534 X:27338431-27338453 GAAAAAAAAGACATACAGATGGG + Intergenic
1188287263 X:28343012-28343034 GAAAATGTACATATACACAACGG - Intergenic
1188473251 X:30563396-30563418 GAGAATGGACTAATACACATGGG + Intronic
1188601560 X:31972512-31972534 GAAATTGTACAATGACAGATTGG + Intronic
1188665484 X:32814774-32814796 GAATATTAACAAATATAGAGTGG + Intronic
1188717593 X:33479046-33479068 GAAAATTAACAAACACATTTGGG + Intergenic
1188809722 X:34638335-34638357 GAAAATGAACACAAACAGTAGGG + Intronic
1188971973 X:36629049-36629071 GAAAATCAACAAAGAAACATTGG - Intergenic
1189631793 X:42961863-42961885 GAAAAGAAACAAATGCAGAGAGG + Intergenic
1189647704 X:43151834-43151856 GAGAATGAAAAAATACCAATTGG - Intergenic
1189777572 X:44484068-44484090 AAGAATGAACAAAGACAGCTTGG + Intergenic
1189795233 X:44639642-44639664 GAACATGAACAAAGACAGTCTGG + Intergenic
1189889735 X:45588126-45588148 GAAAATGAACAAATAATTAATGG - Intergenic
1190047764 X:47126439-47126461 GAAAATGGACTAATACAGGGAGG - Intergenic
1190080157 X:47350460-47350482 GAAAATGAACAAATAAGGCTGGG + Intergenic
1190329601 X:49227483-49227505 AAAAATGAACAAAAATAGCTGGG - Intronic
1190469578 X:50764801-50764823 GAAAATGGACTAATACAAGTTGG - Intronic
1190483925 X:50905323-50905345 ATAAATAAATAAATACAGATAGG + Intergenic
1190748174 X:53339022-53339044 GAAGATGAAGAAAGAGAGATGGG + Intergenic
1190798850 X:53770230-53770252 GAAGATGAAGAAAGAGAGATGGG + Intergenic
1191189015 X:57645978-57646000 GAAAATGTACATATACACATTGG + Intergenic
1191702027 X:64053513-64053535 CAAAACGGACAAATAGAGATTGG - Intergenic
1191924342 X:66293490-66293512 GAAAATAAACAAAGAAACATTGG - Intergenic
1191933324 X:66398480-66398502 GAAAATCAACAAAGAAAGAGAGG + Intergenic
1191985793 X:66979501-66979523 GAAAATCAACAAAGAAATATTGG - Intergenic
1192295085 X:69838884-69838906 GAAGATGAACAAATTTGGATTGG - Intronic
1192615467 X:72616604-72616626 GAAAATCAACAAACAAACATTGG + Intronic
1192688896 X:73338294-73338316 GAAAATGTACATATACACAATGG + Intergenic
1192718413 X:73667279-73667301 GATAAAGAACAAAGACATATTGG - Intronic
1192723136 X:73721499-73721521 GAAAATTAACAAAGACATTTAGG - Intergenic
1192975568 X:76280498-76280520 GAAAATGTACATATACACAACGG - Intergenic
1193003965 X:76595632-76595654 GAAAACGGACTAATACAGATGGG - Intergenic
1193005208 X:76609472-76609494 GAAAATCAACAAAGAAACATTGG + Intergenic
1193017601 X:76753308-76753330 GAAAATTAACAAAGAAACATTGG + Intergenic
1193287775 X:79733310-79733332 GAAAATCAACAAAGAAACATTGG + Intergenic
1193329807 X:80223389-80223411 AAAAATGGACTAATACAGTTAGG + Intergenic
1193361141 X:80580403-80580425 GAAAATCAACAAAGAAATATTGG - Intergenic
1193457728 X:81751696-81751718 GAAAATGAACAAAAAAATTTTGG - Intergenic
1193463254 X:81815273-81815295 GTAAATCAACAAAGACACATTGG - Intergenic
1193530039 X:82645288-82645310 CAAAATGAACAAGGACAGCTTGG - Intergenic
1193562446 X:83035243-83035265 GTAAATCAACAAATAAACATTGG + Intergenic
1193827453 X:86243027-86243049 GAGAATGGACTAATATAGATGGG + Intronic
1193867884 X:86759155-86759177 GAAAATGAACAAATAAATATTGG - Intronic
1193889521 X:87027510-87027532 GAAAATGGACTAATACAGTATGG + Intergenic
1194019875 X:88674266-88674288 GAAAATGAACTAATACAAGAGGG + Intergenic
1194335456 X:92640853-92640875 GAAAATGGACTAATAAAAATGGG + Intergenic
1194352547 X:92839080-92839102 GAAAATGGATTAATACAGATGGG - Intergenic
1194372130 X:93087366-93087388 GAAAATCAACAAATAAACATTGG - Intergenic
1194391293 X:93321096-93321118 GAAAATGTACATATACACAATGG - Intergenic
1194478880 X:94395036-94395058 GAGAATGACCTAATACAGATGGG + Intergenic
1194516416 X:94860659-94860681 GAAAATCAACAAAGAAACATTGG + Intergenic
1194529899 X:95033761-95033783 GAAAATCAACAAAGAAACATTGG - Intergenic
1194542745 X:95194646-95194668 GAAAATTAACAAATATATTTAGG - Intergenic
1194590226 X:95791384-95791406 GAAAATGAAGAAAGAAACATGGG + Intergenic
1194612945 X:96065978-96066000 GAAAATCAACAAAGAAACATTGG - Intergenic
1194632694 X:96305173-96305195 GAAAATCAACAAAGAAACATTGG - Intergenic
1194634623 X:96329495-96329517 GAAAATGAACAAATAATATTGGG - Intergenic
1194689222 X:96962061-96962083 GAAAATCAACAAATAAACATTGG - Intronic
1194838034 X:98706139-98706161 GAAAATTAACAAATAAATATTGG - Intergenic
1194892308 X:99395347-99395369 GAAAATCAACAAAGAAACATTGG - Intergenic
1195298703 X:103506000-103506022 GAAAATGACCACATATGGATTGG + Intronic
1195306704 X:103590356-103590378 GAAATAAAACATATACAGATGGG - Intergenic
1195528897 X:105929023-105929045 GAAAATCAACAAAGAAACATTGG - Intronic
1195592435 X:106645792-106645814 GAAAATCAACAAAGAAATATTGG - Intronic
1195786522 X:108530004-108530026 GAAAATCAACAAAGAAACATTGG + Intronic
1195834620 X:109099999-109100021 AAAAATCAACAAATAAACATTGG - Intergenic
1195844688 X:109213508-109213530 GAGAATGGACAAATACAGTCTGG - Intergenic
1195873719 X:109515356-109515378 GAAAATCAACAAAGAAACATGGG + Intergenic
1196287506 X:113899489-113899511 AAGAATGAACAAGTACAGCTTGG - Intergenic
1196354375 X:114772862-114772884 GAAAATGTAAAAATGCAGAATGG - Intronic
1196357133 X:114808328-114808350 GAAAATGTACACATACACAATGG - Intronic
1196495557 X:116320518-116320540 GAAAATCAACAAAGAAACATTGG + Intergenic
1196508057 X:116472841-116472863 GAAAATCAACAAAGAAACATTGG - Intergenic
1196523636 X:116705634-116705656 GAAAATCAACAAAGAAACATTGG - Intergenic
1196532129 X:116800208-116800230 GATAATGAAAATATACAGAATGG - Intergenic
1196620424 X:117816326-117816348 GAAAATCAACAAAGAAATATTGG - Intergenic
1196822886 X:119717070-119717092 GAAATAAAACACATACAGATTGG + Intergenic
1196970052 X:121098915-121098937 GATAATGGACTAATACAGATGGG - Intergenic
1197309110 X:124882396-124882418 GAAAATTAACAAAGAAACATGGG - Intronic
1197411522 X:126121602-126121624 TAAAATTAACAAATAAACATTGG - Intergenic
1197487366 X:127069900-127069922 GAAAATCAACAAAGAAACATCGG - Intergenic
1197502855 X:127263094-127263116 GAAAATCAACAAAGAAACATTGG + Intergenic
1197568374 X:128117028-128117050 GAAAATGAACTAATACACAAAGG + Intergenic
1198006650 X:132501441-132501463 GAAAATGGCCAAATATACATTGG + Intergenic
1198083593 X:133262714-133262736 GAAAATGGACTAATACAATTGGG - Intergenic
1198223721 X:134626220-134626242 GCAAAAGAAAAAATACAGGTGGG - Intronic
1198626292 X:138579281-138579303 AAAAATGGACTAATACAGATGGG + Intergenic
1198628717 X:138609662-138609684 GAAATGGAAGAAATTCAGATTGG - Intergenic
1198664657 X:139007448-139007470 GAAAATCAACAAACAAACATTGG + Intronic
1198764506 X:140066880-140066902 AAAAATGAAAAAATACAGCTGGG - Intergenic
1198831525 X:140755950-140755972 TAAAATGGACAAGTACATATTGG + Intergenic
1198863173 X:141092328-141092350 GACAATGAACTAATACAGGTTGG - Intergenic
1198899517 X:141495059-141495081 GACAATGAACTAATACAGGTTGG + Intergenic
1198912626 X:141631821-141631843 GAGAATGAACTAATACATAAGGG - Intronic
1199032594 X:143017646-143017668 GAGAATGAACTAATACAGATAGG + Intergenic
1199099146 X:143778745-143778767 GAAAATGTACATATACACAATGG + Intergenic
1199124424 X:144098688-144098710 GAAATTGAAAATATAAAGATAGG - Intergenic
1199186100 X:144917557-144917579 AAAAATGAACAAAGACAGTTTGG - Intergenic
1199189774 X:144956433-144956455 GAAAATGAACAAAGAAACATTGG + Intergenic
1199316985 X:146391841-146391863 GAAAATCAACAAAGAAACATAGG - Intergenic
1199400969 X:147397818-147397840 GCAAATGAACAAAAGCAGACTGG + Intergenic
1199435700 X:147810200-147810222 GAGAATGGACTAATACAAATGGG + Intergenic
1199441285 X:147870507-147870529 GAAAATCAACAAAGAAACATTGG + Intergenic
1199949225 X:152692972-152692994 GAAAAGGAATAAATACAGAGGGG + Intergenic
1199960451 X:152775477-152775499 GAAAAGGAATAAATACAGAGGGG - Intergenic
1200272572 X:154699516-154699538 GCAAAAGAATAGATACAGATTGG + Intronic
1200535665 Y:4394285-4394307 GAAACTGAAAAAAAATAGATGGG + Intergenic
1200643928 Y:5757887-5757909 GAAAATGGACTAATAAAAATGGG + Intergenic
1200660857 Y:5955819-5955841 GAAAATGGATTAATACAGATGGG - Intergenic
1200680184 Y:6201408-6201430 GAAAATCAACAAATAATCATTGG - Intergenic
1201012441 Y:9560901-9560923 GAAAATGAACTAATACAGGAGGG - Intergenic
1201229305 Y:11847922-11847944 GAAAATTAACAAATATATTTGGG + Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201547005 Y:15176381-15176403 GAAACTGAACAAATAGAATTGGG - Intergenic
1202167555 Y:22006839-22006861 AAAAATAAACAACTACACATGGG + Intergenic
1202223805 Y:22579530-22579552 AAAAATAAACAACTACACATGGG - Intergenic
1202319311 Y:23616131-23616153 AAAAATAAACAACTACACATGGG + Intergenic
1202551458 Y:26053926-26053948 AAAAATAAACAACTACACATGGG - Intergenic