ID: 989180076

View in Genome Browser
Species Human (GRCh38)
Location 5:38567802-38567824
Sequence TATAGGCATGAGCCACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1539
Summary {0: 5, 1: 54, 2: 172, 3: 469, 4: 839}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989180070_989180076 2 Left 989180070 5:38567777-38567799 CCTCAACCTCCCAAAGTGCTGGG 0: 2404
1: 92992
2: 214605
3: 237519
4: 262205
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839
989180072_989180076 -4 Left 989180072 5:38567783-38567805 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839
989180067_989180076 6 Left 989180067 5:38567773-38567795 CCCACCTCAACCTCCCAAAGTGC 0: 994
1: 36317
2: 142188
3: 238353
4: 233553
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839
989180066_989180076 20 Left 989180066 5:38567759-38567781 CCACAGGTGATCTGCCCACCTCA 0: 2684
1: 12580
2: 34229
3: 62792
4: 83536
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839
989180065_989180076 25 Left 989180065 5:38567754-38567776 CCTGACCACAGGTGATCTGCCCA 0: 45
1: 8400
2: 27404
3: 63137
4: 90340
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839
989180068_989180076 5 Left 989180068 5:38567774-38567796 CCACCTCAACCTCCCAAAGTGCT 0: 1699
1: 66316
2: 153412
3: 156243
4: 110853
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839
989180075_989180076 -8 Left 989180075 5:38567787-38567809 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839
989180074_989180076 -7 Left 989180074 5:38567786-38567808 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG 0: 5
1: 54
2: 172
3: 469
4: 839

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989180076 Original CRISPR TATAGGCATGAGCCACCACC TGG Intronic
900044879 1:497902-497924 TCGAGGCATGTGCCACCACAAGG - Intergenic
900066679 1:736216-736238 TCGAGGCATGTGCCACCACAGGG - Intergenic
900067075 1:739632-739654 TCGAGGCATGTGCCACCACAAGG - Intergenic
900580539 1:3406452-3406474 TACAGGTGTGAGCCACCACCTGG - Intronic
900878448 1:5363290-5363312 TATAGGCATAGGCCACGCCCTGG + Intergenic
900983780 1:6061326-6061348 TACAGGCGTGAGCCACCGCCCGG - Intronic
901505504 1:9682823-9682845 TACAGTCATGAGCCACCACTGGG + Intronic
901623723 1:10610766-10610788 TACAGGCATGAGCCACTGCCTGG + Intronic
901702308 1:11052203-11052225 TACAGGCATGAGCCACCACCCGG + Intergenic
901941364 1:12664633-12664655 TACAGGCGTAAGCCACCGCCCGG + Intronic
902445830 1:16463599-16463621 TAAAGGCATGAGCCACCACATGG + Intergenic
902553636 1:17233949-17233971 TCTGGGCATGAGTCACCAACAGG - Intronic
902562667 1:17287490-17287512 TCCAGGCAGGAGCCTCCACCTGG - Intergenic
902827286 1:18985320-18985342 TACAGGCGTGAGCCATCGCCTGG - Intergenic
902831626 1:19017569-19017591 TACAGGCATGAGCCACCACCCGG - Intergenic
903087594 1:20876718-20876740 TACAGGCAGGAGCCACCTCCTGG - Intronic
903087618 1:20876856-20876878 TATAGGCACACACCACCACCAGG - Intronic
903414042 1:23169081-23169103 TACAGACTTGAGCCACCACGCGG - Intronic
903414565 1:23173094-23173116 TACAGGTGTGAGCCACCGCCAGG + Intronic
903523279 1:23972131-23972153 CACAGGTGTGAGCCACCACCCGG - Intronic
903529870 1:24021912-24021934 TGCAACCATGAGCCACCACCTGG - Intergenic
903924191 1:26819837-26819859 TACAGGCATGAGCCACCAACCGG - Intergenic
904203942 1:28840392-28840414 TACAGGCATGAGCCACTACCTGG + Intronic
904628893 1:31826715-31826737 TACAGGCATGAGCCACCACCCGG + Intergenic
904638628 1:31904265-31904287 TACAGGCATGAGCCACTGCCCGG - Intergenic
904641469 1:31933980-31934002 TACAGGCATGAGCCACCGCGCGG - Intronic
904720705 1:32505860-32505882 TACAGATATAAGCCACCACCTGG + Intronic
905074649 1:35259171-35259193 TACAGGCTTGAGCCACCAGCTGG - Intergenic
905189533 1:36222984-36223006 TACGGGCATATGCCACCACCCGG - Intergenic
905469553 1:38181603-38181625 TATAGGCGTGAGCCACCACGCGG + Intergenic
905565439 1:38960724-38960746 TACAGGTATAAGCCACCGCCTGG - Intergenic
905576134 1:39046151-39046173 TACAGGCGTGAGCCACCGCCTGG + Intergenic
905679839 1:39861646-39861668 TATAGGCACGACCCACCGCCCGG - Intronic
905698173 1:39991353-39991375 TACAGGTGTGAGCCACCACCCGG - Intergenic
905700837 1:40012421-40012443 TACAGGCGTGAGCCACTACACGG - Intergenic
905814769 1:40940955-40940977 TATAGGCATGAGCCACTACCAGG - Intergenic
906088595 1:43157608-43157630 TACAGGCGTGAGCCACCACCCGG - Intergenic
906232782 1:44179938-44179960 TACAGGTGTGAGCCACCACCCGG + Intergenic
906268161 1:44450906-44450928 TACAGGCGTGAGCCACCACGTGG - Intronic
906465083 1:46071418-46071440 TATAGGCGTGAGCTACCGCGGGG - Intronic
906530249 1:46519879-46519901 TACAGGCGTGAGCCACCGCCTGG + Intergenic
906538612 1:46567216-46567238 TATAGGCGTGAGCCACTGCCTGG + Intronic
906539099 1:46571399-46571421 TACAGGTGTGTGCCACCACCTGG - Exonic
906618114 1:47249283-47249305 TATAGGCGTGAGCCACTGCCTGG - Intergenic
907855211 1:58296529-58296551 CATATGCATGAGCCTCCAGCAGG - Intronic
907864760 1:58389160-58389182 TAGAGGCATGAGCCACTATGGGG - Intronic
908210601 1:61896019-61896041 TATAGGCGTCAGCAACCGCCTGG - Intronic
908236405 1:62151311-62151333 TACAGGCGTGAGCCACCGCCTGG - Intronic
908361663 1:63374350-63374372 TACAGGCGTGAGCCACGGCCCGG - Intronic
908502890 1:64761972-64761994 TACAGGCATGTGCCACCACTAGG - Intronic
908771484 1:67600860-67600882 TACAGGCGTGAGCCACCACATGG + Intergenic
909763265 1:79320883-79320905 TACAGGCATGAGCCAGCGCCTGG + Intergenic
909765420 1:79349602-79349624 TACAGGCATGAGCCAGCGCCCGG + Intergenic
910054940 1:83022467-83022489 TATAGGCACATGCCAACACCTGG + Intergenic
910247842 1:85161448-85161470 TACAGGCGTGAGCCACCACCTGG - Intronic
910583338 1:88852150-88852172 TAGAGGCGTGAGCCCCCATCTGG - Intergenic
910887404 1:91979252-91979274 TACAGGCATGCGCCACCACACGG + Intronic
910943438 1:92561911-92561933 TATAGGCGTGCGCCCACACCTGG + Intronic
910967483 1:92822394-92822416 TACAGGCGTGAGCCACCGCCTGG + Intergenic
911013409 1:93305895-93305917 TACAGGTGTGAGCCACCACATGG - Intergenic
911025412 1:93430955-93430977 TATAGGCATGAGCCACTGGATGG + Intergenic
911031320 1:93491610-93491632 GATAGGCATGAGCTACTGCCAGG + Intronic
911463698 1:98223890-98223912 TACAGACATGAGCCCACACCTGG - Intergenic
911640136 1:100279636-100279658 TATAGGTGTGAGCCACCATATGG - Intronic
912280662 1:108309148-108309170 CATAGGCATGCGCCACCACAAGG - Intergenic
912287564 1:108385209-108385231 CATAGGCATGCGCCACCACAAGG + Intronic
912408169 1:109459779-109459801 TACAGGCGTGAGTCACCGCCTGG + Intergenic
912719275 1:112006083-112006105 GCCAGGCATGAGCCACCAGCTGG + Intergenic
912819891 1:112858675-112858697 TACAGGCGTGAGCCATCACGCGG + Intergenic
912887133 1:113486790-113486812 TACAGTCATGTGCCACCACGTGG + Intronic
912992805 1:114506104-114506126 TATAGGCGTGAGGCACCACCTGG - Intronic
913410868 1:118550013-118550035 TACAGGCGTGAGCCACCACATGG - Intergenic
913438533 1:118872476-118872498 TACAGGCATGAGCCACCATCCGG + Intergenic
913600032 1:120414084-120414106 TACAAGCATGAGCCACCCACTGG - Intergenic
913676678 1:121147306-121147328 TACAGGCGTGAGCCACCGCACGG - Intergenic
914028574 1:143935256-143935278 TACAGGCGTGAGCCACCGCACGG - Intergenic
914087030 1:144462577-144462599 TACAAGCATGAGCCACCCACTGG + Intergenic
914311580 1:146471624-146471646 TACAAGCATGAGCCACCCACTGG - Intergenic
914436804 1:147667713-147667735 TACAGGCGTGAGCCAGCACCCGG - Intronic
914590835 1:149104475-149104497 TACAAGCATGAGCCACCCACTGG + Intergenic
914763062 1:150614626-150614648 TACAGGCATGAGCCACCACCTGG + Intronic
915133276 1:153711441-153711463 TACCGGCATGAGCCACCAGGAGG - Intergenic
915411452 1:155704004-155704026 TACAGGCATGTGCAACCACCTGG - Intronic
915435067 1:155898389-155898411 TACAGGCATGAGCCACCACCTGG - Intronic
915452455 1:156015701-156015723 TACAGGCATGAGCCACCATATGG + Intronic
915718120 1:157963464-157963486 TACAGGCGTGAGCCACAGCCTGG - Intergenic
915957306 1:160232242-160232264 TATAGGCATGAGCCAGTGCCTGG - Intronic
916043246 1:160979405-160979427 CATAGGCATGAGCCACTGTCTGG - Intergenic
916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG + Intergenic
916546506 1:165810640-165810662 TACAGGCATGAGCTACTGCCTGG - Intronic
916548811 1:165830277-165830299 TACAGGTGTGAGCCACTACCTGG + Intronic
916639869 1:166716336-166716358 TAAGGGCATGAGCCACTGCCTGG - Intergenic
916738162 1:167626932-167626954 TACAGGTGTGAGCTACCACCTGG + Intergenic
917140881 1:171834214-171834236 TATAGGCCTGAGCCACTGCCCGG + Intergenic
917157519 1:172020443-172020465 TACAGGCGTGAGCCACCGCGCGG - Intronic
917236669 1:172900063-172900085 TACAGGTATGTGCCACCACATGG + Intergenic
917911342 1:179650123-179650145 TACAGGCGTGAGCCACCAGATGG - Intronic
917936015 1:179867899-179867921 TGTAGGCAAGAGCCACCAGGGGG + Intronic
917996698 1:180446763-180446785 TACAGGCATGAGACTGCACCTGG - Intronic
918045780 1:180940223-180940245 TATAGGCATGAGCCACTGCCTGG - Intronic
918374690 1:183897406-183897428 TAGAGGAATGCGCCACCACCTGG - Intronic
918413190 1:184282034-184282056 TACAGGCATGAGCCACCCGCCGG - Intergenic
918610931 1:186490951-186490973 TACAGGCCTGAGCCACCACCTGG + Intergenic
918888655 1:190233454-190233476 TGCAGGCATAAGCCACCACGTGG + Intronic
919632136 1:199969833-199969855 TATAGGCGTGAGCCACTGCGTGG - Intergenic
919687660 1:200499286-200499308 TAGAGGTATGAGCCACCGCAAGG - Intergenic
920103143 1:203530768-203530790 TATAGTCTTGGGCCACCACCAGG - Intergenic
920320396 1:205117383-205117405 TACAGGCATGAGCCACCACACGG - Intronic
920514292 1:206573183-206573205 TACAGGCATGAGCCACCACACGG - Intronic
921219301 1:212961873-212961895 TACAGGCGTGAGTCACCACACGG + Intronic
921321898 1:213949228-213949250 TACAGGCGTGAGCCACAGCCCGG + Intergenic
921648483 1:217647996-217648018 TACAGGCATGAGTCACCAAGCGG + Intronic
921827594 1:219691242-219691264 TACAGGCATGAGCTTGCACCTGG - Intronic
922101398 1:222480158-222480180 TCGAGGCATGTGCCACCACAAGG - Intergenic
922262480 1:223955270-223955292 TAGAGGTATGTGCCACCACAAGG - Intergenic
922280806 1:224122047-224122069 TACAGGCGTGAGCCACTGCCTGG + Intronic
922453370 1:225754639-225754661 TACAGGCATGAGCCACCACATGG + Intergenic
922806121 1:228390833-228390855 TACAGGCCTGAGCCACCCACTGG - Intergenic
922824832 1:228510515-228510537 TATCAGCCTCAGCCACCACCAGG - Intergenic
922928078 1:229367294-229367316 TATAGGCATGAGCCACGGCCTGG + Intergenic
922951384 1:229560607-229560629 TACAGGTGTGAGCCACCGCCTGG - Intergenic
923172860 1:231432974-231432996 TACAGGCATGCACCACCACCTGG - Intergenic
923315788 1:232778840-232778862 TACAGGCGTGTGGCACCACCCGG - Intergenic
923681093 1:236119328-236119350 TACAGGCGTGAGCTACCACCCGG + Intergenic
923995146 1:239485423-239485445 TACAGGCACATGCCACCACCTGG + Intronic
924344319 1:243060270-243060292 TCGAGGCATGTGCCACCACAAGG - Intergenic
924480588 1:244429612-244429634 TACAGGCGTGAGCCACGGCCCGG - Intronic
924662409 1:246033508-246033530 TACAGGTGTGAGCCAGCACCCGG - Intronic
924760776 1:246983241-246983263 TACAGGCATGTGCCACCATGTGG - Intronic
1062889288 10:1045740-1045762 TACAGGAGTGAGCCACCACACGG + Intronic
1063442489 10:6084250-6084272 TACAGGCATAAGCCTGCACCTGG - Intergenic
1063453405 10:6166366-6166388 TACAGACATGAGCCACCGCCCGG + Intronic
1064074673 10:12259181-12259203 TACAGGCATGAGCCACCAGCTGG + Intergenic
1064250768 10:13704793-13704815 TACAGGCGTGAGCCACTGCCTGG - Intronic
1064742995 10:18452285-18452307 TATAGTCATGCCCCACCACGTGG - Intronic
1064869679 10:19923786-19923808 TACAGGCATGAGCCACTGACTGG - Intronic
1065013178 10:21437781-21437803 TACAGGCGTGAGCCACCACCCGG + Intergenic
1065019525 10:21493412-21493434 TACAGGCGTGAGCAACCACCCGG - Exonic
1065028632 10:21563246-21563268 TATAGGCCTGAGCCACGCGCCGG - Intronic
1065032316 10:21599841-21599863 TACAGGCATGAGCCACTATATGG + Intronic
1065165713 10:22974915-22974937 TATAGGCATGAGCCCCACCCTGG + Intronic
1065302240 10:24333298-24333320 TACAGGCATGAGCCACCACAGGG + Intronic
1065349061 10:24779221-24779243 TGTATTCATGAGCCACCACCTGG - Intergenic
1065682911 10:28255385-28255407 AACAGGCGTGAGCCACCGCCTGG + Intronic
1065826834 10:29580051-29580073 TACAGGCATAAGCCACCACCAGG - Intronic
1066011380 10:31197097-31197119 TACAGGCATAAGCCACCGACTGG - Intergenic
1066067450 10:31772661-31772683 TATAGGCGTGAGCCACCACATGG + Intergenic
1066089423 10:32003097-32003119 TACAGGCATGCACCACCTCCTGG - Intergenic
1066199132 10:33128640-33128662 TACAGGCGTGAGCCACCGCGTGG + Intergenic
1066629281 10:37442882-37442904 TATAGGGGTGAGCCACCACCCGG - Intergenic
1066659563 10:37727024-37727046 TACAGGTGTGAGCCACCACATGG + Intergenic
1066732014 10:38444790-38444812 TAGAGGTATGTGCCACCACAAGG + Intergenic
1066779605 10:38929589-38929611 TACAAGCATGAGCCACCATATGG + Intergenic
1067017267 10:42767676-42767698 TACCGGCATGAGCCACCACCCGG - Intergenic
1068880606 10:62044638-62044660 TACAGTCATGAGCCACCACCAGG + Intronic
1069324085 10:67209322-67209344 TATAAGCATGAGCCACCGCACGG + Intronic
1069453023 10:68532364-68532386 TACAGGCATGAGCCACAACCAGG + Intergenic
1069520959 10:69120839-69120861 TACAGGCATGCCCCACCACCTGG + Intergenic
1069542986 10:69309524-69309546 TACAGGCATGAGCCACCTCGCGG - Intronic
1069711576 10:70492730-70492752 TACAGGTGTGAGCCACCACCTGG + Intronic
1070018755 10:72562427-72562449 TATAGGCATGAGCCACCATGCGG + Intronic
1070087301 10:73249929-73249951 TATAGGCGTGAGCCACCGCCCGG - Exonic
1070125373 10:73617313-73617335 TACAGGCATGCGCCACCGCCTGG - Intronic
1070128800 10:73642440-73642462 TACAGGCGTGAGCCACCGCCAGG + Intergenic
1070293936 10:75142708-75142730 TACAGGCATGAGCCACCACCCGG + Intronic
1070294202 10:75145218-75145240 TACAGGCGTGAGCCACCACCTGG + Intronic
1070625904 10:78050913-78050935 TATAAGCATGAGACACCTGCCGG - Intronic
1070936427 10:80300939-80300961 TATAGGCATGAGGCACTGTCTGG - Intergenic
1070943909 10:80372376-80372398 TACGGGCGTGAGCCACCTCCTGG - Intergenic
1070947194 10:80402526-80402548 TACAGGCATAAGCCACCTTCTGG - Intergenic
1071033777 10:81217200-81217222 TACAGGCATGAGCCACCGTGTGG + Intergenic
1071091933 10:81929100-81929122 TACAGGTGTGAGCCACCACAGGG + Intronic
1071238919 10:83682072-83682094 TACAGGCGTGAGCCACCGTCCGG + Intergenic
1071304476 10:84286196-84286218 TACAGGCATGAGCCAACATGTGG - Intergenic
1071555259 10:86596580-86596602 TACAGGCATGTGCCACCAACGGG - Intergenic
1071690399 10:87812536-87812558 TATAGGCGTGAGCCACCACATGG + Intronic
1072077351 10:91990829-91990851 TACAGGCATGAGCCACTGCCTGG - Intronic
1072161546 10:92771526-92771548 TACAGGCGTGAGCCATCACCCGG + Intergenic
1072359515 10:94646339-94646361 TAGAGGGGTGAGCCACCGCCTGG + Intergenic
1072419751 10:95280232-95280254 TACAGGCACCTGCCACCACCTGG - Intronic
1072432777 10:95388253-95388275 TACAGGCATGAGCCACTGCCCGG + Intronic
1072451921 10:95545415-95545437 TATAGGTGTGAGCGACCACAGGG - Intronic
1072505406 10:96061683-96061705 TACAGGCATGAGCCACCGTGCGG - Intergenic
1072709465 10:97706657-97706679 TACAGGCATGCGCCACTGCCTGG + Intergenic
1072861773 10:99013745-99013767 TACAGGCGTGAGCTACCAGCTGG + Intronic
1072991849 10:100203032-100203054 TACAGGCGTGAGTCACCACCTGG + Intronic
1073090624 10:100935537-100935559 TATAGGCCTGCGCCACCATTAGG - Intronic
1073200048 10:101727916-101727938 TACAGGCATGAGCCATCCACCGG - Intergenic
1073470344 10:103718290-103718312 TACAGGCATAAGCCACCGCACGG + Intronic
1073522257 10:104143984-104144006 TACAGTGGTGAGCCACCACCTGG + Intronic
1074074648 10:110111770-110111792 TACAGGCATGCGCCACCACCCGG - Intronic
1074187638 10:111110688-111110710 TACAGGCATGAGACTGCACCTGG + Intergenic
1074256448 10:111807331-111807353 TATAGGCATGAGCCACTGCCAGG + Intergenic
1074514412 10:114152063-114152085 TACAGGCATAAGCCACTACCTGG - Intronic
1075052660 10:119194395-119194417 TATAGGCGTGAGCCACCATATGG + Intergenic
1075056953 10:119226120-119226142 TACAGGCATGAGCCAGCACCCGG + Intronic
1075163621 10:120046274-120046296 TACAGGCGTGAGCCTGCACCTGG + Intergenic
1075793861 10:125105120-125105142 CATAGGCAGGCGCCGCCACCTGG + Intronic
1076010608 10:126985254-126985276 TACAGGCGTGAGCCACCGCGTGG + Intronic
1076971206 11:134393-134415 TCGAGGCATGTGCCACCACAAGG - Intergenic
1076986591 11:241105-241127 TACAGGTGTGAACCACCACCTGG + Intronic
1077120484 11:905261-905283 TACAGGCGTGAGCCGCCACGTGG - Intronic
1077603213 11:3588728-3588750 AAGAGGCATGAGCCAGAACCGGG + Intergenic
1077747514 11:4923799-4923821 AATAAGCATGAGCCAGCACATGG + Exonic
1077839931 11:5962811-5962833 TACAGGCGTGAGCCACCGTCTGG + Intergenic
1078052595 11:7980014-7980036 TACAGGCATGAGCCACCGCCTGG + Intronic
1078198681 11:9159459-9159481 TACAGGCATGCACCACCACCTGG + Intronic
1078403925 11:11052075-11052097 TACAGGCGTGAGCCACCCGCTGG + Intergenic
1078768994 11:14329387-14329409 TACAGGCACAAGCCACCACGTGG + Intronic
1079210921 11:18460157-18460179 TACAGGCATGAGCCACTGCCTGG - Intronic
1079211999 11:18470198-18470220 TATAGGCGTGAGCCACCGCGTGG + Intronic
1079668991 11:23142570-23142592 TACAGGCATGAGCCACTGCCCGG - Intergenic
1080653290 11:34239604-34239626 TACAGGTCTGAGCCACCACCCGG + Intronic
1080795530 11:35559664-35559686 TATAGGCGTGAGCCACCGCATGG - Intergenic
1080947636 11:36992916-36992938 TACAGGCGTGAGCCACCACCCGG - Intergenic
1081092324 11:38887563-38887585 TACAGGTGTGAGCCACCACCTGG + Intergenic
1081571257 11:44292818-44292840 TACAGGCATGAGCTACCATGCGG - Intronic
1081839851 11:46191955-46191977 TACAGACATGCGCCACCACTTGG - Intergenic
1081873569 11:46393968-46393990 TGTGGGCGTGAGCCACCATCCGG - Intergenic
1081913551 11:46716792-46716814 TACAGGTATGAGCCACTGCCCGG - Intergenic
1082012612 11:47460428-47460450 TACAGGCATGCACCACCACGCGG + Intergenic
1082017116 11:47498262-47498284 CACAGGCATGCACCACCACCTGG - Intronic
1082080267 11:48007382-48007404 TACAGGCATGAGCCACCACACGG + Intronic
1082660488 11:55903833-55903855 CATAGGCAAGAGCCACTAGCTGG + Intergenic
1082669499 11:56017042-56017064 TGCAGGCATGCGCCGCCACCAGG - Intergenic
1083149794 11:60784674-60784696 TGCAGGCATGAGCCACCGCCCGG + Intergenic
1083231660 11:61325195-61325217 TACAGGCATGAACTACCACATGG - Intronic
1083407660 11:62469741-62469763 TATAGGTGTGAGCCACTACGTGG + Intronic
1083472243 11:62891664-62891686 TACAAGCATGAGCCACCAGTTGG - Intergenic
1083554602 11:63615941-63615963 TACAGGCGTGAGCCACCACTCGG + Intronic
1083671545 11:64302844-64302866 TACAGGCGTGAGCCACCACTTGG + Intronic
1083757206 11:64797978-64798000 TACAGGCATGAGCCACACCCGGG + Intronic
1083867366 11:65463704-65463726 TACAGGCGTGAGCCACCACATGG - Intergenic
1083954376 11:65975376-65975398 TATAGATGTGAGCAACCACCCGG + Intronic
1084181016 11:67445936-67445958 TACAGGTGTGAGCCACCACCCGG + Intergenic
1084219971 11:67671816-67671838 TACAGGCATGAGCCACCGTGCGG + Intronic
1084279164 11:68075658-68075680 TACAGGCATGAGCCACCGCCTGG - Intronic
1084293623 11:68194897-68194919 TATAGGCATAAGCCACCACCTGG - Intronic
1084309311 11:68307387-68307409 TATAGGTATGAGCCACCCCCCGG - Intergenic
1084409047 11:68995653-68995675 TACAGGCGTCTGCCACCACCTGG + Intergenic
1084484422 11:69439467-69439489 GACAGGCAGAAGCCACCACCAGG - Intergenic
1084895888 11:72267758-72267780 TACAGGCATTAGCCAGCACCTGG + Intergenic
1085239372 11:75039879-75039901 TACAGGCATGCACCACCACATGG + Intergenic
1085252987 11:75155731-75155753 TACAGGTGTGAGCCACCACGAGG + Intronic
1086348367 11:85920996-85921018 TACAGGCATGAGCCACCGACCGG + Intergenic
1086901341 11:92371439-92371461 TATAGGCATAAGCCACTACCTGG - Intronic
1086982933 11:93218607-93218629 CACAGGCATGAGCCATCGCCCGG - Intergenic
1087264212 11:96043019-96043041 TACAGGCATGAGCCACCACCCGG + Intronic
1087758666 11:102082106-102082128 TACAGGCATGAGCCACTGCACGG - Intronic
1088057612 11:105604182-105604204 TACAGGCGTGAGCCACCGCGCGG + Intergenic
1088255901 11:107903409-107903431 TACAGGCGTGAGCCACCGCTAGG + Intronic
1088366005 11:109040613-109040635 TACAGGTGTGAGCCACCACCTGG - Intergenic
1088622322 11:111698464-111698486 TACAGGTGTGAGCCACCACCTGG - Intronic
1089073904 11:115721710-115721732 TGCAGGCATGTGCAACCACCTGG + Intergenic
1089230862 11:116974529-116974551 TACAGGCATGTGCCACCATAGGG + Intronic
1089239539 11:117064872-117064894 TACAGGCGTGAGCCACCGCCTGG - Intronic
1089260438 11:117220517-117220539 AACAGGCATGAGCCACCATGGGG + Intronic
1089449126 11:118579394-118579416 TACAGGCATGAGCCACCGCCCGG - Intronic
1090028404 11:123186796-123186818 TACAGGCATGAGCCAGAGCCTGG + Intronic
1090211953 11:124927143-124927165 TACAGGCATGAGCCACTGCGTGG + Intronic
1090270748 11:125384408-125384430 TACAGGCGTGAGCCACCACCCGG - Intronic
1090377343 11:126300478-126300500 TACAGGTATGAGCCACCACGTGG + Intronic
1090630114 11:128638258-128638280 TATAGGTATGAACCACCTGCGGG - Intergenic
1090823534 11:130366654-130366676 TACAGGCACATGCCACCACCTGG - Intergenic
1091502286 12:1030021-1030043 TATAGGCGCGAGCCACCGCCAGG + Intronic
1091598256 12:1895770-1895792 TATAGCCATGTGCCACCACATGG + Intronic
1091927125 12:4361890-4361912 TACAGGCATGAGCCACCACCCGG + Intergenic
1092169198 12:6362818-6362840 TACAGGCTTGTGCCACCACATGG + Intronic
1092228106 12:6761973-6761995 TATAGGCGTGAACCACCACGTGG - Intronic
1092267957 12:6997725-6997747 TACAGGCAGGCGCCACCACACGG + Intronic
1092278174 12:7078352-7078374 TACAGGCATGTGCCACCACCTGG + Intergenic
1092337157 12:7643284-7643306 TACAGGCGTGAGCCACCGCCTGG - Intergenic
1092374390 12:7943226-7943248 TACAGGCGTGAGCCACCGCGCGG + Intergenic
1092668214 12:10830923-10830945 TACAGGCCTGAGCCCGCACCCGG + Intronic
1092819143 12:12336795-12336817 TATAGGCATGAGCTACCACATGG + Intronic
1093064633 12:14644206-14644228 TACAGGCATGAGCCATCACGGGG - Intronic
1093520731 12:20047060-20047082 TACAGGCGTGAGCCACCGCGCGG + Intergenic
1093853679 12:24071707-24071729 TACAGGCATGAGCCACTGCCCGG + Intergenic
1094548410 12:31427327-31427349 TACAGACGTGAGCCACCGCCTGG - Intronic
1094584445 12:31764842-31764864 TACAGGCATGAGCCATCCACAGG + Intergenic
1094587811 12:31794102-31794124 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1094698197 12:32842514-32842536 TACAGGCATGAGCCATTGCCTGG + Intronic
1094749661 12:33391210-33391232 TACAGGCGTGAGCCAACGCCTGG + Intronic
1095050485 12:37549813-37549835 TACAGGCTTGAGCCAGCGCCTGG - Intergenic
1095055281 12:37591062-37591084 TACAGTCATTAGCCACCACGTGG - Intergenic
1095202815 12:39405074-39405096 TATATGCATGAGCCAGTGCCTGG - Intronic
1095440483 12:42234710-42234732 TATAGGAATGAGCCACCATTCGG - Intronic
1095794401 12:46201915-46201937 TATAGGCGTGAGCCACCGCGCGG - Intronic
1096125779 12:49118531-49118553 CAAAGGCATGTACCACCACCAGG + Intergenic
1096247714 12:50002744-50002766 TACAGGCATGAGCCATCGCCTGG - Intronic
1096300163 12:50419762-50419784 TACAGGTTTGAGCCACCACGTGG - Intronic
1096447112 12:51703417-51703439 TACAGGCGTGAGCCACCATTAGG + Intronic
1096820956 12:54233905-54233927 TGCAGGCGTGAGCCAGCACCCGG - Exonic
1096821086 12:54235337-54235359 TACAGGCGTGAGCCACCGCCGGG - Exonic
1097017633 12:55998567-55998589 TACAGGCATGAGCCACTGTCCGG - Intronic
1097031266 12:56091611-56091633 TATAGGCATGCGCCGCTGCCAGG + Intronic
1097048953 12:56209138-56209160 TACAGGCGTGAGCCACCGCACGG + Intronic
1097063920 12:56306280-56306302 TACAGGCATGAGCCACTGCCTGG - Intronic
1097283682 12:57861582-57861604 TACAGGCGTGAGCCACCAAAAGG + Intergenic
1097921055 12:65074540-65074562 TACAGGCATGAGCCAGCACCTGG - Intronic
1097989051 12:65815361-65815383 TAGTGGCATAAGCCACAACCTGG + Intergenic
1098059110 12:66541088-66541110 TACAGGCATGAGTCACTGCCCGG + Intronic
1098337539 12:69419495-69419517 TACAGGTGTGAGCCACCACCTGG + Intergenic
1098716962 12:73841357-73841379 TACAGGTGTGAGCCACCACCCGG - Intergenic
1099095725 12:78372179-78372201 TACAGGCATGAGCCACTGCATGG + Intergenic
1099483335 12:83196171-83196193 TACAGGCATGAGCCACCTCCCGG - Intergenic
1099611653 12:84879599-84879621 TACAGGCGTGAGCCACCGCCTGG + Intronic
1099858034 12:88193943-88193965 TACAGGCATCAGCCACTGCCTGG - Intronic
1099969904 12:89489936-89489958 GATAGGCCAGAGTCACCACCTGG + Intronic
1100080014 12:90837818-90837840 TTTAGGCATGAACCACCACCTGG - Intergenic
1100080768 12:90847289-90847311 TACAGGCATGAGCCACCATGCGG + Intergenic
1100200035 12:92288356-92288378 TACAGGCGTGAGCCACCGCCCGG + Intergenic
1100356682 12:93837541-93837563 TACAGGCATGAGCCACCGGGCGG + Intronic
1100563394 12:95771262-95771284 TACAGGCGTGAGCCACCGCGCGG + Intronic
1100641045 12:96482617-96482639 TACAGGCATGCACCACCACGGGG - Intergenic
1101385996 12:104258648-104258670 TAGAGGCATGAGTCACCAACAGG - Intronic
1101510504 12:105388602-105388624 TATAGGCATGAGCCACTGCCCGG + Intronic
1101528879 12:105556655-105556677 TACAGGCATGAGCCACCACGTGG + Intergenic
1101779128 12:107819849-107819871 CACAGGCATGCCCCACCACCTGG - Intergenic
1101953529 12:109194578-109194600 TACAGTCATGAGCCACCCCCTGG + Intronic
1102159641 12:110758080-110758102 TACAGGCGTGAGCCTGCACCTGG - Intergenic
1102685667 12:114722669-114722691 TACAGGCATGAGCCACCACAGGG + Intergenic
1102882106 12:116493532-116493554 TATTGGCATGCGCCACCACTCGG + Intergenic
1103150248 12:118631874-118631896 TACAGGCATGAGCCACTGCGTGG + Intergenic
1103234828 12:119362821-119362843 TATAGGCCTGAGCCACCTTGTGG - Intronic
1103336808 12:120195787-120195809 TACAGGCATGTGCCACCACTCGG - Intergenic
1103352534 12:120294791-120294813 TATAGGCATGAGCTGCCGCCCGG + Intergenic
1103474996 12:121211462-121211484 TACAGGCGTGAGCCCCCACGCGG + Intronic
1103475333 12:121213922-121213944 TACAGGCGTGAGCTACCACAGGG - Intronic
1103487754 12:121294893-121294915 TACAGGCATGAGCTGCCACCTGG - Intronic
1103645418 12:122388492-122388514 TACAGGCGTGAGCCACCACCCGG + Intronic
1103818209 12:123676001-123676023 TACAGGCATGAGCCACCACCTGG - Intronic
1104009451 12:124919145-124919167 TACAGGCATGCACCACCGCCTGG - Intergenic
1104760066 12:131292427-131292449 TATAGGCGCCCGCCACCACCTGG - Intergenic
1105233672 13:18525009-18525031 TACAAGCATGAGCCACCATATGG + Intergenic
1105379864 13:19876947-19876969 TACAGGCGTGAGCCACCGCCTGG - Intergenic
1105509102 13:21036497-21036519 TACAGGCGTGAGCCACCGCAAGG - Intronic
1105517001 13:21099827-21099849 TACAGGTATGAGCCACCGCTCGG - Intergenic
1105951157 13:25230446-25230468 TACAGGCATGAGCCACGGCCTGG + Intergenic
1106306176 13:28512443-28512465 TATAGGTGTGAGCCACTGCCCGG + Intergenic
1106337593 13:28797882-28797904 CACAGGCATGAGCCACTGCCTGG - Intergenic
1107003173 13:35575013-35575035 TATCGGCGTGAGCCACCATGCGG + Intronic
1107115532 13:36742101-36742123 TTGAGGCATGAGCCAGCCCCCGG + Intergenic
1107209392 13:37835008-37835030 TACAGGCATGAACCACCAGCAGG + Intronic
1107515031 13:41120679-41120701 TACAGACATGAGCCACCGCCTGG + Intergenic
1107917165 13:45164455-45164477 TACAGGCATGAGCCACTACCTGG - Intronic
1108366906 13:49724870-49724892 TAGAGGCATGAGCCACCTGTGGG + Intronic
1108392761 13:49963786-49963808 TATAGGTGTGAGCCACCATGCGG - Intergenic
1108404247 13:50083552-50083574 TACAGGCGTGAGCCACCGCGTGG + Intronic
1108499908 13:51060433-51060455 TATAGGCACCCGCCACCACGTGG - Intergenic
1108844084 13:54657354-54657376 TACAGGTGTGAGCCACCACACGG + Intergenic
1109113999 13:58357673-58357695 TACAGGCATGAGCCACCTTCGGG + Intergenic
1109237731 13:59845184-59845206 TATAGGCATAAACCACCACCTGG + Intronic
1109263321 13:60168293-60168315 TACAGGCGTGAGCCACCGCCCGG + Intergenic
1109440856 13:62370959-62370981 TATAGGCATGAGCCGCCACCTGG + Intergenic
1109607422 13:64714540-64714562 TACAGGCATGAGCCACTTCACGG + Intergenic
1109753495 13:66726980-66727002 TATGCGCATGAGCCACTGCCTGG - Intronic
1110255468 13:73429142-73429164 TACAGGCATGAGTCACAGCCCGG - Intergenic
1110639170 13:77802188-77802210 TACAGGTGTGAGCCACCACCTGG - Intergenic
1110741309 13:79000449-79000471 TACAGGCATGAGCCACCATAAGG - Intergenic
1111057027 13:82964669-82964691 TACAGGCATGAGCCACCACCAGG - Intergenic
1111214003 13:85119706-85119728 TGGTGGCATGAGCCACCAGCTGG + Intergenic
1111344893 13:86938892-86938914 TACAGGAGTGAGCCACCACGTGG - Intergenic
1111477838 13:88776522-88776544 TACAGGCATGAGACACCGCGCGG - Intergenic
1111497814 13:89076112-89076134 TACAGGCATGAGCTACCAAGTGG + Intergenic
1112281590 13:98067474-98067496 TATAGGCACCCACCACCACCAGG + Intergenic
1112281639 13:98067997-98068019 TATAAGCATGAGCCACCGCCTGG - Intergenic
1112288024 13:98121242-98121264 TATAGGCATGAGCCACTGCCTGG - Intergenic
1112309493 13:98305607-98305629 TACAGGCGTGAGCCACCACGCGG + Intronic
1112469757 13:99676732-99676754 TACAGGCATGCCCCACCACTGGG + Intronic
1112480529 13:99770993-99771015 TACAGGCGTAAGCCACCACGCGG + Intronic
1112545469 13:100364906-100364928 TACAGGTGTGCGCCACCACCAGG - Intronic
1112863308 13:103862207-103862229 TACAGGCATGCGCCACCACGCGG + Intergenic
1112976646 13:105327814-105327836 GAGAGGCATCAGCCAGCACCCGG - Intergenic
1113454972 13:110441943-110441965 TATAGGCATGAACCACACCCAGG - Intronic
1113726950 13:112611657-112611679 TATAGGTGTGTGCCACCACAAGG - Intergenic
1113741711 13:112716032-112716054 TCCAGGCAGGAGCCACCCCCAGG - Intronic
1113879557 13:113616293-113616315 TACAGACAGGAGCCACCACACGG - Intronic
1114192869 14:20453744-20453766 TACAGGCATGAGCCACCGCTCGG - Intronic
1114280819 14:21191469-21191491 TACAGGAATGAGCCACCATGCGG - Intergenic
1114445572 14:22785450-22785472 TACAGGCGTGAGCCAGCGCCTGG - Intronic
1114488650 14:23081487-23081509 TACAGGCATGAGCCACTGCCTGG - Intronic
1114497713 14:23145186-23145208 TACAGGCAGGAGCCACCGCCCGG + Intronic
1115109881 14:29808673-29808695 TACAGGCATGAACCACCTTCAGG + Intronic
1115211687 14:30972931-30972953 TACAGGCGTGAGCCCGCACCCGG - Intronic
1115251139 14:31349245-31349267 TACAGGCATGTGCCACCACCCGG - Intronic
1115341476 14:32297272-32297294 TACAGGCATGAGCCACCAGATGG - Intergenic
1115546571 14:34469777-34469799 TACAGGCGTGAGCCACCGTCTGG - Intergenic
1115591152 14:34866345-34866367 TACAGGCATGTGCCACCACGTGG - Intronic
1115993318 14:39171449-39171471 TACAGGCATGAGCCACCTTGCGG - Intergenic
1116018733 14:39436115-39436137 TATAGGCAGGATCCCCCAACGGG + Intergenic
1116226324 14:42157600-42157622 TAGAGGCATCAACCACTACCTGG + Intergenic
1116335239 14:43648897-43648919 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1116438585 14:44923387-44923409 TACAGGTGTGGGCCACCACCTGG - Intergenic
1116801134 14:49444059-49444081 TACAGGCATGAGCCACCGTGCGG + Intergenic
1116883752 14:50197963-50197985 TACGGGCGTGATCCACCACCTGG + Intronic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1117231556 14:53724581-53724603 TACAGGCATGAGCCTACCCCTGG + Intergenic
1117298255 14:54397853-54397875 TACAGGCGCGAGACACCACCCGG - Intronic
1117349656 14:54869012-54869034 TACAGGCATGCACCACCACCTGG + Intronic
1117400741 14:55356586-55356608 TACAGGCATGCGCCACCACGTGG + Intronic
1117544704 14:56783149-56783171 TACAGGCATGAGCCACCTCACGG - Intergenic
1117703323 14:58437433-58437455 TATAGGCATGAGCCACTGTCTGG - Intronic
1118031804 14:61825403-61825425 TACAGGCATGAGCCCCAGCCAGG - Intergenic
1118625273 14:67653062-67653084 TACAGGCATGAGCCACCGCACGG + Intronic
1118834524 14:69467493-69467515 TACAGGCATGAGCCACCACACGG - Intergenic
1119066399 14:71531703-71531725 TACAGGCATGATGAACCACCAGG + Intronic
1119067148 14:71540403-71540425 TACAGACATGAGCCACCACCAGG - Intronic
1119197858 14:72731023-72731045 TACAGGCATGTGCCACCATCTGG - Intronic
1119237999 14:73035677-73035699 TATAGGCGTGAGCCACCTTGCGG - Intergenic
1119286651 14:73460177-73460199 AACAGGCATGAGCCACCGCACGG - Intronic
1119469646 14:74887014-74887036 TACAAGCATGAGCCACTGCCCGG + Intronic
1119515106 14:75241844-75241866 TACAGGTATGAGCCACCACTCGG - Intronic
1119714672 14:76850589-76850611 TATAGGCATGAGCCACTGCACGG - Intronic
1119738257 14:76997776-76997798 TATAGGTGTGAGCCACTGCCTGG - Intergenic
1119848499 14:77848178-77848200 TACAGGCATGAGCCCCGGCCTGG + Intronic
1120128833 14:80781180-80781202 GACAGGCATGAGCCACTGCCTGG - Intronic
1121105363 14:91275780-91275802 GACAGGCATGAGCCACCGCTTGG + Intronic
1121284394 14:92724005-92724027 TATAGGTGTGAGCCACCACCCGG + Intronic
1121286918 14:92743224-92743246 TACAGGCGTGAGCCACTGCCCGG - Intronic
1121296120 14:92825877-92825899 TATAGGCATAAGCCACCCTATGG - Intronic
1121409504 14:93739788-93739810 TACAGGCGTGAACCACCATCAGG - Intronic
1121816317 14:96931840-96931862 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1122155001 14:99745339-99745361 CACAGGCATGAGCCATCATCCGG + Intronic
1122460698 14:101892230-101892252 TACAGGTATGAGCCACCGCCTGG + Intronic
1122727764 14:103770236-103770258 TACAGGCATGAGCTACCACCTGG - Intronic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1122988836 14:105226831-105226853 CACAGGCATGAGCCACGCCCAGG - Intronic
1122993894 14:105252197-105252219 TACAGGCATGAGACCGCACCTGG - Intronic
1202937658 14_KI270725v1_random:106666-106688 TACAAGCATGAGCCACCATATGG - Intergenic
1123459980 15:20460794-20460816 TACAGGCATGAGCCACTGCCTGG + Intergenic
1123564585 15:21530982-21531004 TACAGGCATGAGCCACATGCTGG + Intergenic
1123658082 15:22539625-22539647 TACAGGCATGAGCCACTGCCTGG - Intergenic
1123814138 15:23959680-23959702 TACAGGCATGAGCCACCGCAAGG - Intergenic
1123975731 15:25552940-25552962 TACAGGCGTGAGACACCGCCCGG - Intergenic
1124196301 15:27633322-27633344 TACAGGCGTGAGCTACCACCTGG + Intergenic
1124266206 15:28236564-28236586 TACAGGCATGAGCCACTGCCTGG + Intronic
1124311944 15:28634117-28634139 TACAGGCATGAGCCACTGCCTGG - Intergenic
1124478603 15:30058620-30058642 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1124665917 15:31592603-31592625 TACAGGCGTGAGCCACCGCGCGG - Intronic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1124990376 15:34667263-34667285 TATGGGCATGAGCCACCAAAGGG + Intergenic
1125215884 15:37274076-37274098 TACAGACATGAGCCACCGCGCGG - Intergenic
1125545818 15:40503949-40503971 TACAGGCATGACCCACCACCCGG - Intergenic
1125549069 15:40530850-40530872 TATAGGCGTGCGCCACCACCCGG + Intronic
1125669826 15:41462894-41462916 TATAGGCGTGTGCCACCACCTGG + Intronic
1125806752 15:42499866-42499888 TACAGGCATGAACCACCGCCCGG - Intronic
1125816981 15:42593941-42593963 TACAGGCGTGAGCCACCGCGTGG + Intronic
1125819990 15:42621027-42621049 TATAGGGGTGAGCCACCACCTGG + Intronic
1125830771 15:42715781-42715803 TACAGGCATGAGCCACCGCCCGG + Intronic
1125858558 15:42975169-42975191 TACAGGTGTGAGCCACCACCCGG + Intronic
1125952903 15:43768746-43768768 TACAGGCATGAGCCACCGCTTGG - Intronic
1126317216 15:47383039-47383061 TACAGGCATGAGCCACCACCTGG + Intronic
1126319510 15:47407087-47407109 TACAGGCATGAGCCACCCCCCGG - Intronic
1126575408 15:50191782-50191804 TACAGGCATGAGCCACTGCCTGG - Intronic
1126625223 15:50679956-50679978 TACAAGCGTGAGCCACCGCCCGG - Intronic
1126768864 15:52035357-52035379 TACAGGCGTGAGCCACTGCCCGG - Intronic
1126776003 15:52101031-52101053 TACAGGCATGAGTCACCGCCTGG - Intergenic
1127506226 15:59600432-59600454 TACAGGCGTGAGCCACCGCATGG - Intronic
1127753022 15:62064736-62064758 TACAGGCATGCACCACTACCTGG - Intergenic
1127825248 15:62697246-62697268 TATAGGCATGTACCACCACTCGG + Intronic
1128030845 15:64478652-64478674 TACAAGTATGAGCCACCACATGG + Intronic
1128142350 15:65311052-65311074 TATAGGCATGAGCCATGCACTGG - Intergenic
1128155672 15:65390136-65390158 TAAAGGCATTAGTCCCCACCTGG + Exonic
1128275575 15:66350652-66350674 TACAGGCGTGAGCCACTGCCCGG - Intronic
1128651571 15:69418839-69418861 TGCAGGCATGAGCCTCCATCTGG - Intronic
1129210063 15:74063252-74063274 TACAGGCACGTGCCACCACCAGG - Intergenic
1129403960 15:75302150-75302172 TACAGGCAAGTGCCACCACCAGG + Intergenic
1129476971 15:75792179-75792201 TACAGGCACGTGCCACCACCAGG + Intergenic
1129512203 15:76132652-76132674 TACAGGCATGCGCCACCACCTGG - Intronic
1129744925 15:78011787-78011809 TACAGGCATGTGCCACCGTCTGG + Intronic
1129775297 15:78232823-78232845 TACAGGCACGTACCACCACCTGG + Intronic
1129821215 15:78603288-78603310 TACAGGCTTGAGCCACTGCCTGG + Intronic
1129875872 15:78975107-78975129 TACAGGAGTGAGCCACCACTCGG - Intronic
1129994277 15:79991161-79991183 TATGGGCAGGAGCCAGCAGCTGG - Intergenic
1130289112 15:82581115-82581137 TACAGGCATGAGCCAATGCCTGG + Intronic
1130516131 15:84627119-84627141 AACAGGCATGAGCCACCACTCGG + Intronic
1130517722 15:84639048-84639070 TACAGGCCTGAGCCACCACGGGG + Intergenic
1130528868 15:84730535-84730557 TACAGACATGTGCCACCACATGG + Intergenic
1130641895 15:85684284-85684306 TACAGGCGTGAGCTACCGCCTGG - Intronic
1130826499 15:87552245-87552267 TACAGGCGTGAGCCACCACTAGG + Intergenic
1131085481 15:89572482-89572504 TACAGGCATGAGCCACCACCCGG - Intergenic
1131181993 15:90246645-90246667 TACAGGCATCTGCCACCACACGG - Intergenic
1131185542 15:90270949-90270971 TACAGGCATGAGCTACCACGTGG - Intronic
1131484490 15:92808875-92808897 TACGGGCGTGAGCCACCGCCCGG - Intronic
1131545141 15:93309602-93309624 TACAGGCATGAGCCACCGTGCGG - Intergenic
1131764617 15:95661969-95661991 TACAGGTATGAGCCACCACGTGG - Intergenic
1131941614 15:97572914-97572936 TAAAGCCATGAGCCGTCACCTGG + Intergenic
1132470273 16:98660-98682 TATAGGCATGAGCCAGTCCTTGG - Intronic
1132505312 16:305190-305212 TGTAGGCGTGAGCCACCACCTGG - Intronic
1132781754 16:1630425-1630447 TACAGGCACGAGCCACCACCTGG + Intronic
1133093026 16:3419790-3419812 TACAGGCATGAACCACCCCTTGG - Intronic
1133200604 16:4202064-4202086 TACAGGCGTGAGCCACCAGGAGG + Intronic
1133362452 16:5185337-5185359 TACAGTCATGAGGCACCACCCGG - Intergenic
1133409339 16:5555524-5555546 TACAGGCATGAGCCACTGCACGG + Intergenic
1133738332 16:8632479-8632501 TATAGGTGTGAGCCACTACCCGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1133786845 16:8980531-8980553 TATAGGCATGAGCCCACAATTGG - Intergenic
1134026692 16:10959530-10959552 TACAGGCATGCACCACCACGTGG + Intronic
1134438257 16:14281524-14281546 TACAGGCATGTGCCACCACGTGG - Intergenic
1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG + Intronic
1134877088 16:17710509-17710531 TATAGGCATGAGCCACTGTTTGG - Intergenic
1135028502 16:19017542-19017564 TACAGGCATGAACCACCACCTGG - Intronic
1135038321 16:19096979-19097001 TAGAGGGGTGAGCCACCCCCTGG - Intergenic
1135045386 16:19150919-19150941 TACAGGCGTGAGCCACAGCCCGG + Intronic
1135091242 16:19519707-19519729 CACAGGCATGAGCCACTGCCTGG - Intronic
1135406638 16:22203009-22203031 TACAGGCATAAGCCACCGCCTGG + Intergenic
1135578748 16:23607081-23607103 TATAGGCGTGAGCCACTGCCTGG + Intronic
1136015199 16:27393965-27393987 GACAGGCATGAGCCACCACCTGG - Intergenic
1136054912 16:27681105-27681127 TACAGGTGTGAGCCACCGCCTGG + Intronic
1136457028 16:30385998-30386020 TACAGACATGAGCCACTGCCTGG - Intronic
1136464578 16:30433481-30433503 TACAGGTATGAGCCACTGCCCGG + Intergenic
1136482262 16:30549566-30549588 TACAGGCATGAGTCACTGCCTGG + Intronic
1136489773 16:30599417-30599439 TACAGGTGTGTGCCACCACCTGG + Intergenic
1136491026 16:30608555-30608577 TACAGGCATGAGCCACCAGCCGG + Intronic
1136621106 16:31428817-31428839 TACAGGCATGAGCCACTACACGG + Intergenic
1136704387 16:32173985-32174007 TACAGGCATGAGCCACCGCCTGG + Intergenic
1136763525 16:32755421-32755443 TACAGGCATGAGCCACCGCCTGG - Intergenic
1136804575 16:33114965-33114987 TACAGGCATGAGCCACCGCCTGG + Intergenic
1137232607 16:46581022-46581044 TACAAGCGTGAGCCACCGCCTGG + Exonic
1137235906 16:46617900-46617922 TATAGGCATGAGCCACTGCCTGG - Intronic
1137265222 16:46863265-46863287 TACAGGCGTGAGCCACTGCCCGG + Intergenic
1137265303 16:46864280-46864302 TACAGGTGTGAGCCACCTCCTGG - Intergenic
1137277916 16:46949192-46949214 TACAGGCGTGAGCCACCGCCCGG + Intergenic
1137716537 16:50601721-50601743 CAGAGCCAGGAGCCACCACCAGG + Intronic
1137803443 16:51282609-51282631 TATAGGAATTAGCCATGACCTGG + Intergenic
1138380239 16:56595707-56595729 TACAGGCATGTACCACCACCTGG - Intergenic
1138425280 16:56927977-56927999 TACAGGTGCGAGCCACCACCTGG - Intergenic
1138430715 16:56966888-56966910 TATAGGCGTGAGCCACGGCCTGG + Intronic
1138498975 16:57426782-57426804 TATAGGTGTGAGCCACTGCCTGG - Intergenic
1138566499 16:57837190-57837212 TATAGGCAAGAGCCACCACCTGG - Intronic
1138634645 16:58328020-58328042 TAAAGGCGTGTGCCACCACCTGG - Intronic
1139433329 16:66922954-66922976 TACAGGCGTTAGCCACCCCCTGG + Intronic
1139441224 16:66968441-66968463 TACAGGCATGAGGCTGCACCCGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1139646358 16:68333911-68333933 TACAGGCATGCACCACCACCTGG + Intronic
1139750075 16:69104569-69104591 TACAGGCGTGAGCCTGCACCCGG + Intergenic
1139781219 16:69352977-69352999 TAAGAGCATGAGCCCCCACCGGG - Intronic
1140184215 16:72752244-72752266 TACAGGCGTGAGCCACCACCTGG + Intergenic
1140313583 16:73872508-73872530 TACAGGCATGAGCCACTGCCAGG + Intergenic
1140334482 16:74091855-74091877 TACAGGCGTGAGCCACTACACGG + Intergenic
1140390370 16:74581555-74581577 TACAGGCATGAAGCACCTCCTGG - Intronic
1140523366 16:75601479-75601501 TACAGGCGTGAGCCACCGCCTGG - Intronic
1140784794 16:78330027-78330049 TACAGGCATGAGTCACTGCCTGG + Intronic
1141003863 16:80334092-80334114 TACAGGCGTGAACCACCACCTGG - Intergenic
1141146624 16:81535223-81535245 TACAGGTGTGAGCCACCACGTGG + Intronic
1141147055 16:81538304-81538326 TGCAGGCAGGAGCCACCGCCGGG - Intronic
1141232404 16:82181443-82181465 TACAGGCATGGGCCACTGCCTGG + Intergenic
1141321546 16:83014588-83014610 TACAGGCATGGGCCACCACTCGG - Intronic
1141918714 16:87120433-87120455 TATTTGCATGAGCCCCCACATGG + Intronic
1141959997 16:87399285-87399307 TATAGGCATGAGCCACTGGCTGG + Intronic
1142002787 16:87672867-87672889 TATAGGCACAAGCCACTGCCTGG - Intronic
1142295009 16:89215661-89215683 TACAGGCGTGAGCCACCGCACGG - Intergenic
1203065674 16_KI270728v1_random:1015742-1015764 TACAGGCATGAGCCACCGCCTGG - Intergenic
1142458444 17:72160-72182 TCGAGGCATGTGCCACCACAAGG - Intergenic
1142549155 17:727497-727519 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549171 17:727563-727585 AATAGGCAGGAGCCACCTCCTGG + Intergenic
1142549188 17:727629-727651 AATAGGCAGGAGCCACCTCCTGG + Intergenic
1142549206 17:727695-727717 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549222 17:727761-727783 AATAGGCAGGAGCCACCTCCTGG + Intergenic
1142549240 17:727827-727849 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549256 17:727893-727915 AATAGGCAGGAGCCACCTCCTGG + Intergenic
1142549274 17:727959-727981 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142573299 17:889551-889573 TACAGGCACACGCCACCACCAGG - Intronic
1142587568 17:983233-983255 TACAGGCATGAGCCACCACCCGG + Intergenic
1142615773 17:1134135-1134157 TACAGGCGTGAGTCACCACCCGG - Intronic
1142729281 17:1840559-1840581 TACAGGCGTGAGCCACCACCTGG + Intronic
1142853611 17:2717491-2717513 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1142951394 17:3483931-3483953 TACAGGCATGAGTCACTGCCTGG + Intronic
1142988480 17:3712669-3712691 TACAGGCATGAGCCAAATCCGGG - Intergenic
1143657501 17:8304395-8304417 TACAGGCATGCGCCACCGCCAGG + Intergenic
1143704317 17:8686636-8686658 TACAGGTATGAGCCACCACCCGG + Intergenic
1143853024 17:9827010-9827032 TACAGGTACGTGCCACCACCCGG + Intronic
1143949008 17:10618298-10618320 TATAGGCGTGAGCCACTAGGTGG - Intergenic
1144113470 17:12062602-12062624 TACAGGCATGAACCACTGCCTGG + Intronic
1144184081 17:12779807-12779829 TACAGGCATGAGCCACCGCCCGG + Intergenic
1144697198 17:17312992-17313014 TACAGGTGTGAGCCAGCACCCGG - Intronic
1144855674 17:18266234-18266256 TATAGGCGTGAGCCACAGCGCGG - Intronic
1145187108 17:20804265-20804287 TATAGGAATGAGCCACCGTGTGG - Intergenic
1145305539 17:21672603-21672625 TACAGGCATGAGCCAGAGCCTGG + Intergenic
1145371120 17:22306912-22306934 TACAGGCATGAGCCAGCGCCTGG - Intergenic
1145708915 17:26950258-26950280 TACAAGCATGAGCCACCATATGG + Intergenic
1145742585 17:27288018-27288040 TACAGGCATGAGCCACCACTTGG + Intergenic
1145840759 17:27992238-27992260 TACAGGCATGAGCAACCACACGG + Intergenic
1146027997 17:29339719-29339741 TACAGGCATGAGCCACTCCATGG - Intergenic
1146048023 17:29526554-29526576 TACAGGCATGCACCACCACCTGG + Intronic
1146110692 17:30086468-30086490 TACAGGTGTGAGCCACCACCTGG - Intronic
1146133282 17:30296626-30296648 TCCAGGCATGAGCCACTGCCCGG - Intergenic
1146407548 17:32552350-32552372 TACAGGCATGAGCCACAGCCTGG + Intronic
1146606573 17:34263583-34263605 TACAGGCACGCGCCACCACCCGG + Intergenic
1146851390 17:36224848-36224870 TATAGGCATAAGCCACCACCTGG - Intronic
1146867300 17:36348721-36348743 TATAGGCATAAGCCACCACCTGG - Intronic
1147070177 17:37949332-37949354 TATAGGCATAAGCCACCACCTGG - Intergenic
1147081698 17:38028858-38028880 TATAGGCATAAGCCACCACCTGG - Intronic
1147097649 17:38152828-38152850 TATAGGCATAAGCCACCACCTGG - Intergenic
1147212911 17:38882521-38882543 TATAGGCATGAGCCACTGCCCGG + Intronic
1147291774 17:39449454-39449476 TACAGCCTTGAGCCACTACCTGG + Intronic
1147491483 17:40871416-40871438 TACGGGCATGAGCCACCTCAAGG + Intergenic
1147610435 17:41798885-41798907 TATAGGAATGAGCCACCACCAGG - Intergenic
1147737965 17:42653049-42653071 TACAGGCATGTGCCACCACCCGG + Intergenic
1147912666 17:43865515-43865537 TACAGGTGTGAGCCACCACGCGG + Intergenic
1147943215 17:44065157-44065179 TACAGGCCTGAGCCACCGCCCGG - Intronic
1148005931 17:44429532-44429554 TACAGGCGTGAGCCACCACGTGG - Intronic
1148221213 17:45863720-45863742 TACAGGTGTGAGCCACCAACAGG + Intergenic
1148274512 17:46291643-46291665 TATAGGCATGAGCCACCGTATGG - Intronic
1148423257 17:47566937-47566959 TACAGGCATGAGGCGCCACTAGG - Intronic
1148731770 17:49841159-49841181 TACAGGCATGAGCCACTGCCTGG + Intronic
1148750865 17:49945062-49945084 TACAAGCATGAGCCACCGCACGG - Intergenic
1148838303 17:50478259-50478281 TAAGGGCATGAGCCACCACCAGG - Intergenic
1148879867 17:50717654-50717676 TACAGGCGTGAGCCACCAAGTGG - Intergenic
1148903473 17:50896064-50896086 TACAGGCGTGAGCCACCACTAGG + Intergenic
1148917639 17:50995938-50995960 TATAGGCATGAGTCAATAACAGG + Intronic
1148944574 17:51248973-51248995 TATAGGTGTGAGCCACCATGCGG - Intronic
1149287783 17:55185144-55185166 TACAGGCATGAACCACCACCTGG + Intergenic
1149320865 17:55479307-55479329 GATAGGCGTGAGCCACCACACGG - Intergenic
1149745061 17:59088778-59088800 TACAGGTATGAGCCACTACCTGG + Intronic
1149789395 17:59464017-59464039 TACAGGCATGCGCCACCACCTGG - Intergenic
1149870007 17:60172566-60172588 TACAGGTGTGAGCCACCACACGG - Intergenic
1150045605 17:61910318-61910340 TACAGGCGTGAGCCACCACTGGG - Intronic
1150077842 17:62208331-62208353 GACAGGTAAGAGCCACCACCCGG + Intergenic
1150098395 17:62399441-62399463 TACAGGCGTGAGCCACCGCCTGG + Intronic
1150180953 17:63120536-63120558 TACAAGCATGAGTCACCACCTGG - Intronic
1150262579 17:63807414-63807436 TACAGGCGTGAGCCACTGCCCGG + Intronic
1150345358 17:64400398-64400420 TATAGGCATGTGCCACCGCCCGG - Intronic
1150408544 17:64922906-64922928 TATAGGCATGAGCCACCGTATGG + Intergenic
1150441143 17:65192471-65192493 CACGGGCATGTGCCACCACCTGG - Intronic
1150491227 17:65575693-65575715 TACAGGCACCCGCCACCACCCGG - Intronic
1150715145 17:67566477-67566499 TACAGGCATGAGCCACCCACAGG + Intronic
1150770667 17:68038248-68038270 TACAGGCGTGAGCCACTGCCCGG + Intronic
1150773280 17:68059735-68059757 TACAGGCATGCACCACCACACGG + Intergenic
1150777068 17:68089723-68089745 TACAGGCATGCGCCGCCACCTGG + Intergenic
1151024355 17:70659831-70659853 TACAGGCGTGAGCCACCATGCGG + Intergenic
1151207695 17:72520036-72520058 TACAGGTATGAACCACCTCCCGG - Intergenic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1151520937 17:74629063-74629085 TACAGGCGTGTGCTACCACCAGG - Intergenic
1151612492 17:75185376-75185398 TACAGGCGTGAGCCACCAGAGGG - Intergenic
1151612513 17:75185479-75185501 TACAGGCGTGAGCCACCAGAGGG - Intergenic
1151806982 17:76411824-76411846 TACAGGCACATGCCACCACCCGG + Intronic
1151810251 17:76435969-76435991 TACAGGCGTGAGCCACCGCACGG - Intronic
1151901006 17:77015026-77015048 TACAGGTGTGAGCCACCGCCTGG - Intergenic
1151962523 17:77414348-77414370 TACAGGCATGAGTCACCGCGTGG + Intronic
1151990093 17:77569149-77569171 TATAGGCGTGAGCGACAACATGG + Intergenic
1152171585 17:78753395-78753417 AACAGGCATGAGCCACTGCCTGG - Intronic
1152175701 17:78785800-78785822 TACAGGCATGAGCCTGCTCCTGG + Intergenic
1152316725 17:79585278-79585300 TACAGGCGTGAGCCATCATCTGG - Intergenic
1152457862 17:80426371-80426393 TACAGGCGTGAGCCACCCTCCGG - Intronic
1152687067 17:81699797-81699819 TATAGGCGTGAGCCACCGCCCGG - Intronic
1152763707 17:82123402-82123424 TACAGGAGTGAGCCACCGCCCGG + Intronic
1153023086 18:648931-648953 TACAGGCATGAGCCACTGCCTGG + Intronic
1153280179 18:3407577-3407599 TACAGGCATGAGCCCACGCCTGG - Intergenic
1153530598 18:6041996-6042018 TATGGGCATGAACTACCACCCGG + Intronic
1153687781 18:7564071-7564093 TACAGGTGTGAGCCACCACATGG + Intergenic
1153753811 18:8260437-8260459 TACAGGCATGAACCACCTCCTGG + Intronic
1154228824 18:12534832-12534854 TACAGGCATGAGCCTGCACCTGG + Intronic
1154265972 18:12879277-12879299 TACAGGGATGAGCCACCGCCTGG + Intronic
1154275706 18:12957982-12958004 TATAGGCGTGAGCCACTACGAGG + Intronic
1154307458 18:13241068-13241090 TACAGGCATGTGCCACTACCCGG + Intronic
1154364944 18:13699080-13699102 TACAGGCGTGAGCCACCGCCTGG + Intronic
1154519348 18:15210451-15210473 TACAAGCATGAGCCACCATATGG - Intergenic
1154954296 18:21240655-21240677 TACAGACATGAGCCACCGCGTGG + Intergenic
1154986564 18:21556973-21556995 TACAGGCATGAGCCACTGACCGG + Intronic
1155009066 18:21757174-21757196 TACAGGCGTGAGCCACCGCATGG - Intronic
1155323624 18:24644082-24644104 TACAGGCATGTGCCACCATGCGG + Intergenic
1156459576 18:37314169-37314191 TATAGGCGTGAGCCACCGTGTGG - Intronic
1156669477 18:39451221-39451243 TACAGGCGTGAGCCACCGCGCGG - Intergenic
1156740641 18:40323415-40323437 TAAAAGGATAAGCCACCACCTGG + Intergenic
1157330648 18:46701414-46701436 TACAGGCATGAGCTACCGCAGGG + Intronic
1157426927 18:47592046-47592068 AATAGGCATGAGAGGCCACCTGG + Intergenic
1157665186 18:49480047-49480069 TACAGGCATGAGCCACTGCCTGG - Intronic
1157731162 18:50005690-50005712 TACAGGCATGAGCCACTGCCTGG + Intronic
1157859693 18:51129647-51129669 TATAGGCGTGAGCCACTTGCCGG - Intergenic
1158241193 18:55380155-55380177 TACAGGTGTGAGCCACCACGAGG + Intronic
1158356772 18:56629921-56629943 TACAGGCATGAGCCATCATCGGG - Intronic
1158391711 18:57050258-57050280 TACAGGCTTGAGCCACTGCCCGG + Intergenic
1158999430 18:62958062-62958084 TACAGGCTTGCGCCACCACCTGG + Intronic
1159736915 18:72111605-72111627 TACAGGCGTGAGCCACTGCCCGG + Intergenic
1159863463 18:73676117-73676139 TAGATGCATGTACCACCACCTGG - Intergenic
1160169703 18:76543097-76543119 TATAGGCGTGAGCCCGCACCTGG - Intergenic
1160203381 18:76813463-76813485 TACAGGCATGAGCCAACATCCGG + Intronic
1160803503 19:980901-980923 TACAGGCATGAGCCACCGCCTGG - Intergenic
1160932897 19:1578906-1578928 TACAGGCATGAGCCTCTACCTGG - Intronic
1160934988 19:1590344-1590366 TACAGGCATGAGCCACTGCCTGG - Intronic
1161289638 19:3486247-3486269 TACAGACATGAGCCACCACCTGG - Intergenic
1161624960 19:5320984-5321006 TACAGGCATGAGCCAGCACCGGG - Intronic
1161714876 19:5869926-5869948 TATAGGCATGTGCCAGCACCTGG - Intronic
1161828303 19:6584582-6584604 TACAGGCATGAGCCACTGCCTGG - Intronic
1161852889 19:6746916-6746938 TATAGGCATGAGCCACTGCCCGG + Intronic
1162024353 19:7885178-7885200 TACAGGCATGCGCCACCACTCGG - Intergenic
1162047126 19:8007451-8007473 TACAGGCATGAGCCACCACCCGG + Intronic
1162048958 19:8020636-8020658 TACAGGCATGTGCCACCATGCGG + Intronic
1162082495 19:8226628-8226650 TACAGGCATGAGCCACTACACGG - Intronic
1162137678 19:8565811-8565833 GACAGGTGTGAGCCACCACCCGG - Intronic
1162289174 19:9765791-9765813 TACAGGCATGAGCCACCCCCTGG - Intronic
1162417942 19:10549396-10549418 AACAGGCGTGAGCCACCACACGG + Intronic
1162447479 19:10732323-10732345 TACAGGCATGAGCCACCGCCCGG - Intronic
1162664357 19:12197005-12197027 TACAGGCATGTGCCTCCACACGG + Intergenic
1162692132 19:12441519-12441541 TACAGGCACGCGCCACCACCCGG + Intronic
1162845410 19:13388529-13388551 TACAGGCGTGAGCCACCCCCTGG + Intronic
1162908433 19:13836812-13836834 CATATGCAGGAGCCACCACACGG + Intergenic
1163072285 19:14854281-14854303 TACAGGCATGTGCCACCATGCGG + Intergenic
1163136249 19:15313395-15313417 TACAGGCATGAGCCACCGCTCGG - Intronic
1163150650 19:15411378-15411400 TACAGGCATGAGCCACTGCCCGG - Intronic
1163162579 19:15474058-15474080 TACAGTCGTGAGCCATCACCCGG - Intronic
1163335190 19:16666677-16666699 TATAGGCATGAGCCACCGCAGGG - Intronic
1163418030 19:17198457-17198479 TATAGGCGTGAGCCACTGCCTGG - Intronic
1163452711 19:17388159-17388181 TACAGGCGTGAGCCACCCCCGGG + Intergenic
1163765254 19:19160243-19160265 TACAGGTGTGAGCCACCACACGG + Intronic
1163770651 19:19189108-19189130 TACAGGAGTGAGCCACCGCCCGG + Intronic
1163837663 19:19584895-19584917 TACAGGCGCGAGCCACCTCCTGG + Intronic
1163929877 19:20378736-20378758 TATGGGCCTGAGCCATCGCCTGG + Intergenic
1163985527 19:20944335-20944357 TACAGGCATGAGCCACTGCCTGG + Intronic
1164178227 19:22796549-22796571 TACAGGCGTGAGTCACCAGCCGG + Intergenic
1164461956 19:28456524-28456546 CACAGGCATGAGCCACCTGCTGG - Intergenic
1164698720 19:30266323-30266345 TATAGGCATGAGTCACCACCTGG + Intronic
1164702065 19:30292594-30292616 TATAGGCATGAGCCACTGCTAGG + Intronic
1164836691 19:31359564-31359586 TACAGGCATGAGCCACCACAGGG - Intergenic
1164844885 19:31423528-31423550 TACAGACATGAGCCACGAACCGG - Intergenic
1164942411 19:32261390-32261412 TATAGGCATGAACCACTGCCTGG - Intergenic
1165182078 19:33980002-33980024 TACAGGCATGAGCCACCGCCTGG - Intergenic
1165188091 19:34039329-34039351 TACAGGCATGCACCACTACCTGG + Intergenic
1165347934 19:35260566-35260588 TACAGGCATGAGCCACTGCCCGG + Intronic
1165458232 19:35927509-35927531 CACAGGCGTGAGCCACCACGTGG + Intergenic
1165676446 19:37728255-37728277 TACAGGCGTGAGCCACCATGCGG + Intergenic
1165706699 19:37981281-37981303 TACAGTCACGTGCCACCACCTGG - Intronic
1165998375 19:39862062-39862084 TACAGGCGTGAGCCACCATGGGG + Intergenic
1166084965 19:40468353-40468375 TATAGGCGTGAGCCACCGCCTGG + Intronic
1166091262 19:40510744-40510766 TACAGGCGTGAGCCACTGCCTGG - Intronic
1166129348 19:40736778-40736800 TATAGGCATGATCCCACACCTGG + Intronic
1166352363 19:42205805-42205827 TACAGGCATGAGCCACCGCCTGG - Intronic
1166395594 19:42438081-42438103 TACAGGTGTGAGCCCCCACCTGG - Intronic
1166411499 19:42558387-42558409 TACAGGCATGAGCCACTGCTTGG + Intronic
1166427521 19:42692780-42692802 CATGGGCAGAAGCCACCACCTGG + Intronic
1166712785 19:44948093-44948115 TACAGGCACCCGCCACCACCCGG - Intronic
1166719477 19:44988903-44988925 TACAGGCGAGAGCCACCACCAGG - Intronic
1166837346 19:45675608-45675630 TACAGGCATGAGCCACTGCCGGG - Intronic
1167098949 19:47392175-47392197 TACTGGCATGAACCACCGCCCGG + Intergenic
1167110222 19:47456386-47456408 TACAAGCATGAGCCATCATCCGG - Intronic
1167202438 19:48075322-48075344 TACAGGCACGCACCACCACCAGG + Intronic
1167252523 19:48407910-48407932 TACAGGCATGAGCCACAGCCCGG - Intronic
1167739294 19:51314457-51314479 TACAGGCATGAGCCACTGTCTGG + Intronic
1167905620 19:52658267-52658289 TACAGGCATGAGCCAGAACCTGG - Intronic
1168045331 19:53790221-53790243 TATAGGCGTGAGCCACCACGTGG + Intergenic
1168055030 19:53858691-53858713 TATAGGCATGAGCCAGGTCGTGG - Intergenic
1168397693 19:56063062-56063084 TACAGGCATGAACCACCACACGG - Intergenic
1168497523 19:56866258-56866280 TACAGGCATGAGCCACCGAGAGG - Intergenic
1168607327 19:57770295-57770317 TACAGGCATGCGCCACCACGGGG + Intronic
1168655847 19:58127225-58127247 TACAGGCATGAGACACTGCCTGG - Exonic
1168697630 19:58413774-58413796 TACAGGCGTGAGCCACCACCCGG + Intronic
1168708654 19:58484554-58484576 TACAGGTGTGAGCCACCACATGG - Intronic
925570279 2:5303172-5303194 TACAGGCATGTGCCACCACCAGG - Intergenic
925818508 2:7776792-7776814 TACAGACGTGAGCCACCGCCTGG + Intergenic
926003494 2:9353287-9353309 TACAGGCATGAGCCACTGCCTGG - Intronic
926011101 2:9408613-9408635 TACAGGCATGAGCCACCATGTGG + Intronic
926175882 2:10591726-10591748 TGCAGGCATGAACCACCACCTGG - Intronic
926400969 2:12496224-12496246 TATCGGCATCAGCCTTCACCAGG - Intergenic
926673737 2:15601409-15601431 TAGAAGCATAAGCCACAACCTGG - Intronic
926704835 2:15829651-15829673 TATAGGCATGAGCCACCACCAGG - Intergenic
926753453 2:16217941-16217963 TACAGGCATGAACCACCGCCTGG - Intergenic
926895922 2:17688422-17688444 TACAGGCATGAGCCACTGCATGG - Intronic
927161626 2:20268334-20268356 TACAGGCCTGAGCCACCGCATGG - Intronic
927170250 2:20363243-20363265 TACAGGCATGAGCCACCCCCGGG - Intergenic
927332607 2:21883433-21883455 TAGAGGCATGAGCCGCCACTCGG + Intergenic
927661721 2:24998923-24998945 TACAGGCACCTGCCACCACCTGG - Intergenic
927763441 2:25781935-25781957 AACAGGCGTGAGCCACCGCCCGG + Intronic
927808179 2:26166605-26166627 TATAGGCAGGTACCACCACCTGG + Intergenic
927955072 2:27202224-27202246 TACAGGCATGAGCCACCGCTCGG - Intronic
927977298 2:27348526-27348548 TACAGGCATGAGCCTGTACCTGG - Intronic
928282355 2:29959779-29959801 TACAGGCGTGAGCTACCACCTGG - Intergenic
928582579 2:32723938-32723960 TAAAGGCATGAGCCACCAGCTGG + Intronic
928690891 2:33797469-33797491 TACAGGCGTGAGCCACCGCACGG - Intergenic
929157364 2:38800042-38800064 TACAGGCATACGCCACCACCCGG - Intronic
929214621 2:39398765-39398787 TATAGGCATGAGCCAATGCCTGG - Intronic
929594381 2:43167170-43167192 TACAGGCGTGAGCCACCACAAGG - Intergenic
929600051 2:43199273-43199295 TACAGGTGTGAGCCACCACGGGG + Intergenic
929637147 2:43535401-43535423 TACAGGCGTGAGCCACCGCCTGG - Intronic
929741295 2:44603364-44603386 TACAGGCATGAGCCACCAACTGG + Intronic
929857046 2:45646246-45646268 TACAGGCATGAGCCACCAGGTGG + Intergenic
930055437 2:47248461-47248483 TATAGGCGTGAGCCACTGCATGG + Intergenic
930087432 2:47507733-47507755 TACAGGCGTGAGCCTCCACCTGG + Intronic
930199347 2:48538092-48538114 TACAGGCACGCGCCACCACGTGG + Intronic
930601258 2:53445647-53445669 TATAGGCATCAGAAACAACCAGG - Intergenic
930638786 2:53834423-53834445 TACAGGCGTGGGCCACCGCCCGG - Intergenic
930769354 2:55116201-55116223 TATAGGCATGAGTCACTGCCGGG + Intergenic
930789103 2:55305569-55305591 TACAGGCATGAACCACTGCCTGG - Intronic
930809416 2:55525174-55525196 TATAGGCATGAGCCACTTCCTGG - Intronic
931017400 2:57999865-57999887 TATAGGCATGAGCCACTAACTGG - Intronic
931018656 2:58016633-58016655 TACAGCCGTGAGCCACCACCTGG + Intronic
931187803 2:59970767-59970789 TACAGGCGTGAGCCACCGCGAGG - Intergenic
931276977 2:60752780-60752802 TACAGGCCGGAGCCACCACGTGG + Intergenic
931337920 2:61367350-61367372 TACAGACACGAGCCACCACCTGG - Intronic
931354160 2:61519420-61519442 TACAGGCATGAGCCACTGCCTGG - Intronic
931691092 2:64835490-64835512 TACAGGCATGAGCCACCGCAGGG + Intergenic
931693671 2:64856378-64856400 TACAGGCGTGAGCCACCCCCCGG - Intergenic
931803031 2:65777321-65777343 TACAGGCGTGTGCTACCACCTGG + Intergenic
932205851 2:69881963-69881985 CACAGGCATGAGCCACTGCCCGG + Intergenic
932476433 2:72009241-72009263 TACAGGCATGAGTCACCACGTGG + Intergenic
932612728 2:73211740-73211762 TACATGTGTGAGCCACCACCCGG + Exonic
932668313 2:73715670-73715692 TACAGGCATGTGCCACCACCCGG + Intergenic
932723797 2:74160205-74160227 TACAGGCACGAGCCACCACACGG - Intronic
933406015 2:81860516-81860538 TACAGGCATAAGCCCACACCTGG - Intergenic
933716182 2:85362641-85362663 TACAGGCATGAGCCACTTACTGG - Intronic
934249606 2:90338582-90338604 TACAAGCATGAACCACCACATGG - Intergenic
934259970 2:91464865-91464887 TACAAGCATGAACCACCACATGG + Intergenic
934303274 2:91796784-91796806 TACAAGCATGAGCCACCATATGG + Intergenic
934468209 2:94285885-94285907 TACAAGCATGAGCCACCATATGG - Intergenic
934747305 2:96767794-96767816 TACAGGCGTGAGCCACAGCCAGG - Intronic
935152942 2:100454795-100454817 TACAGGCATGAACCACTGCCTGG - Intergenic
935547849 2:104419510-104419532 TACAGGCGTGAGCCAACGCCAGG - Intergenic
935755827 2:106275694-106275716 CACAGGCATGAGCCACCGCTGGG + Intergenic
935759792 2:106310374-106310396 TACAGGTGTGAGCCACCGCCTGG + Intergenic
935956272 2:108379888-108379910 TATAGACATGAGCCAACATGAGG - Intronic
935971096 2:108531670-108531692 TACAGGCCTGAGCCACCGCGCGG + Intergenic
935988027 2:108693437-108693459 TACAGGCACAAGCCACCACTTGG + Intergenic
936711966 2:115142047-115142069 CAGAGGCATGAGCCAGCACGTGG + Intronic
937001075 2:118468137-118468159 TACAGGCGTGAGCCACAGCCTGG - Intergenic
937206881 2:120242462-120242484 TATAGGCATCAGCCCCCAAAGGG - Intronic
937270251 2:120645355-120645377 TACAGGCTTGAGCCCACACCCGG + Intergenic
937367513 2:121274671-121274693 TACAGGCATGAGCCACTGCCTGG - Intronic
937445089 2:121950632-121950654 TACAGGCATGAGCCACTGCCTGG + Intergenic
938003645 2:127769210-127769232 TACAGGCATGAGGCACCTCGAGG - Intronic
938033249 2:128013787-128013809 TACAGGTGTGAGCCACCACATGG - Intronic
938519335 2:132051080-132051102 TACAAGCATGAGCCACCATATGG - Intergenic
938829606 2:135037271-135037293 TACAGGCGTGAGCCATCACCTGG + Intronic
938830125 2:135042225-135042247 TACAGGCGTGAGCCACTACCTGG - Intronic
938837935 2:135127148-135127170 TACAGGCATGAGCCACCGCGCGG + Intronic
938845603 2:135205624-135205646 TACAGGTATGAGCCAACGCCTGG + Intronic
939147372 2:138432280-138432302 TACAAGCATGAGCCACTGCCTGG - Intergenic
939481970 2:142760425-142760447 TATAAGCATAAGCCACCATGTGG - Intergenic
939688408 2:145227712-145227734 TACAGGCGTGAGCCACTGCCTGG + Intergenic
939746773 2:145981610-145981632 TACAGGCATAAGCCACCCCGCGG + Intergenic
940889790 2:159024166-159024188 TATAGTCATGTGCCACAACATGG + Intronic
941026044 2:160457403-160457425 TACAGGCGTGAGCCACCGCGCGG + Intronic
941321667 2:164063257-164063279 TACAGGCATGTGCCACCACACGG + Intergenic
941822710 2:169858456-169858478 TGTAGGTATGTGCCACCACACGG + Intronic
941848427 2:170154805-170154827 TACAGGCATGAGCCACAGCTAGG - Intergenic
941985547 2:171507425-171507447 TACAGGCATGACCCACCACACGG + Intergenic
942267022 2:174238351-174238373 TATAGGCATGCGCCACCACCAGG - Intronic
942426674 2:175867712-175867734 TACAGGTGTGAGCCACCATCCGG - Intergenic
942438721 2:176009095-176009117 TACAGGTGTGAGCCACCACGTGG - Intergenic
942843304 2:180391057-180391079 AACAGGCATTAACCACCACCTGG + Intergenic
943431561 2:187809268-187809290 TACAGGCATGAGTCTGCACCTGG - Intergenic
943465148 2:188219613-188219635 TATAGACATGAGCCACTGTCTGG + Intergenic
943898084 2:193393765-193393787 TACAGGCATGAGCCATTGCCTGG - Intergenic
944510984 2:200465755-200465777 TACAGGTGTGAGCCATCACCTGG - Intronic
944714727 2:202367274-202367296 TACAGGCGTGAGCCACCGCCCGG + Intergenic
944889926 2:204106885-204106907 TACAGGCATGAGCCACTGCCCGG + Intergenic
945076706 2:206047052-206047074 TACAGGCGTGAGCCACCGCCTGG + Intronic
945082411 2:206099160-206099182 TACAGGCGTGAGCCACCTCGCGG + Intergenic
945227221 2:207544180-207544202 TACAGGCGTGAGCCACTGCCCGG + Intronic
945303990 2:208241363-208241385 TATAGGCATGCGACCACACCTGG + Intronic
945324426 2:208465676-208465698 TATAGGCATGAGCCACCGCAGGG + Intronic
946209152 2:218133572-218133594 TACAGGTGTGAGCCACCACTGGG + Intronic
946210106 2:218140758-218140780 TACAGGCGTGAGCCCACACCTGG - Intergenic
946446998 2:219748379-219748401 TATAGGCATGAGCCACTGCCTGG + Intergenic
946659476 2:221984337-221984359 TACAGGCATGAGCCACTGCATGG + Intergenic
947213172 2:227726268-227726290 GGCAGACATGAGCCACCACCTGG - Intergenic
947557031 2:231102092-231102114 TACAGGCATGAGCCACCCATTGG + Intronic
947687307 2:232099488-232099510 TACAGGCATGAGCCACTGCCTGG + Intronic
947688154 2:232109168-232109190 TACAGGCATGAGCCACCGCCTGG - Intronic
947774339 2:232696124-232696146 TACAGGCGTGAGCCACTGCCCGG + Intergenic
947782965 2:232786510-232786532 TATAGGCGTGAGCCACCACGCGG + Intronic
948005424 2:234604102-234604124 TACAGGCATGAGCCAAAAACTGG - Intergenic
948038884 2:234883419-234883441 TATAGGCATGAGCCACAGCATGG - Intergenic
948129623 2:235590994-235591016 TACAGGCGTGAGCCACCGCCCGG + Intronic
1168806995 20:677292-677314 TACAGGCTTGAACCACCACGAGG - Intergenic
1169184458 20:3602686-3602708 TACAGGCATGAGCCACCGCCCGG - Intronic
1169379245 20:5092573-5092595 TACAGGCATGTGCCACCACCTGG - Intronic
1169390807 20:5189421-5189443 TACAGACATGAGCCACTGCCTGG - Intronic
1169893684 20:10479622-10479644 TACAGGCGTGAGCCACGTCCCGG + Intronic
1170529785 20:17279528-17279550 TACAGGCGTGAGCCACCACTGGG - Intronic
1170587025 20:17742553-17742575 TATAGGCATGAGCCGTCACCCGG - Intergenic
1170777165 20:19385910-19385932 TACAGGCATGAGCCACCACCTGG + Intronic
1170834239 20:19869921-19869943 TACAGGCGTGAGCCACCTCACGG + Intergenic
1171314971 20:24182409-24182431 TACAGGCGTGAGCCACCCCGTGG - Intergenic
1171456214 20:25273986-25274008 TGTAGGCGTGAGCCTCCGCCTGG + Intronic
1171507842 20:25653415-25653437 TACAGGCGTGAGCCACCGCCAGG + Intergenic
1171523054 20:25790092-25790114 TACAGGCATGAGCCAGAGCCTGG + Intronic
1171530792 20:25852069-25852091 TACAGGCATGAGCCAGAGCCTGG + Intronic
1171544998 20:25993330-25993352 TACAGGCATGATCCAGCACCTGG - Intergenic
1171553773 20:26065791-26065813 TACAGGCATGAGCCAGAGCCTGG - Intergenic
1171750553 20:29044581-29044603 TATAGGCATGATCCCCCTGCTGG - Intergenic
1171967193 20:31539518-31539540 TACAGGCATGAGCCACCACCTGG - Intronic
1172127511 20:32633734-32633756 CAGAGGCAGGAGGCACCACCAGG - Intergenic
1172168249 20:32912159-32912181 TACAGGCGTGAGCCACTGCCTGG - Intronic
1172289457 20:33765653-33765675 TATAGGAATGAGCCATCACACGG + Intronic
1172709498 20:36909947-36909969 TACAGGCGTGAGACACCGCCCGG - Intronic
1172723923 20:37021716-37021738 TACAGGCATGAGCCTGCGCCCGG + Intronic
1173054406 20:39597347-39597369 CAGAGGCATGAGCCATGACCTGG + Intergenic
1173724337 20:45286894-45286916 AACAGGCATGAGCCATCGCCTGG + Intergenic
1173791689 20:45832167-45832189 TACAGGCATGTGCCACCATGCGG - Intronic
1173893418 20:46531108-46531130 TATAGGCATGCACCACTACACGG + Intergenic
1173911817 20:46676182-46676204 TACAGACACAAGCCACCACCTGG + Intronic
1173911975 20:46677187-46677209 TACAAGCACAAGCCACCACCTGG + Intronic
1174232533 20:49058045-49058067 TACAGGCCTGAGCCACTGCCCGG + Intronic
1174519255 20:51117083-51117105 TACAGGCGTGAGCCATCACTTGG - Intergenic
1174617852 20:51850132-51850154 TACAGGCATGAGCCACACACTGG - Intergenic
1174946559 20:54992641-54992663 TATAGACACGAGCCACCATGCGG - Intergenic
1175829460 20:61954090-61954112 TACAGGCATGCACCACCACCTGG - Intronic
1175905196 20:62376222-62376244 TACAGGTGTGAGCCACCGCCTGG + Intergenic
1176314654 21:5231335-5231357 TATAGGCATGATCCCCCTGCTGG + Intergenic
1176777656 21:13153284-13153306 TACAAGCATGAGCCACCATATGG + Intergenic
1177435629 21:21048626-21048648 TACAGGCGTGAGCTACCACCTGG + Intronic
1177675009 21:24285479-24285501 TATAGGCATGAGCCCCCTTGCGG + Intergenic
1178311372 21:31532804-31532826 TGCAGGCATGCGCCACCACACGG - Intronic
1178444318 21:32624750-32624772 TATAGGCGTGAGCCACCACCTGG + Intergenic
1178813632 21:35907207-35907229 TATAGGCATGAGCCACTGCCTGG - Intronic
1178879059 21:36434177-36434199 TACAGGCATGAGCCACCACCCGG + Intergenic
1179207174 21:39292226-39292248 TATAGGCATGAGCCATCGCTAGG + Intronic
1179412677 21:41174414-41174436 TACAGGCGTGAGCCACCGCGCGG + Intronic
1179678769 21:43002988-43003010 TACAGGCGTGAGCCACTGCCCGG + Intronic
1179811115 21:43870434-43870456 TACAGGTGTGAACCACCACCCGG - Intronic
1180392443 22:12297293-12297315 TATAGGCATGATCCCCCTGCTGG + Intergenic
1180407305 22:12567475-12567497 TATAGGCATGATCCCCCTGCTGG - Intergenic
1180647559 22:17352100-17352122 CATAGGCGTGAGCCACTGCCTGG + Intergenic
1180682778 22:17639993-17640015 TACAGGCATGCGCCACCACGCGG + Intronic
1181109656 22:20594271-20594293 TACAGTCATGAGTCACTACCTGG - Intergenic
1181160265 22:20956074-20956096 TACAGGCATGAGCCACCACCTGG + Intergenic
1181256186 22:21564307-21564329 TACAGGCATGAGTCACCACAAGG + Intronic
1181839279 22:25642155-25642177 TACAGGCGTGAGCCACCGCGCGG - Intronic
1181949838 22:26545934-26545956 TATAGGCAGGTACCATCACCTGG - Intronic
1182216655 22:28724130-28724152 TACAGGCGTGAGCCCCCGCCTGG - Intronic
1182272199 22:29161839-29161861 TTACAGCATGAGCCACCACCCGG - Intronic
1182374496 22:29836826-29836848 TACAGGCATGAGTCACTGCCCGG + Intronic
1182375708 22:29846190-29846212 TAGAGGCATGAGCCACTACCTGG - Intergenic
1182607741 22:31519845-31519867 GATAGGCATGAGTCACTGCCTGG + Intronic
1183069173 22:35384357-35384379 TAGAGGTGTGAGCCACCACCCGG + Intronic
1183102326 22:35591611-35591633 CACAGTCATGAGCCACCTCCTGG + Intergenic
1183159416 22:36101808-36101830 TATAGGTGTGAGCCACCATCCGG + Intergenic
1183255848 22:36761669-36761691 TACAAGCCTGAGCCACCAACAGG + Intronic
1183404205 22:37622354-37622376 TACAGGCATGAGCCACTGCCTGG + Intronic
1183422608 22:37720786-37720808 TACAGGTGTGAGCCACTACCAGG + Intronic
1183555292 22:38521426-38521448 TATAGGTGTGAGCCACCACAAGG - Intronic
1183609602 22:38890624-38890646 TACAGGCATGAGCCACTGCCTGG - Intergenic
1183959268 22:41401424-41401446 TACAGGCGTAAGCCACCGCCCGG - Intergenic
1183977107 22:41518656-41518678 TACAGCTGTGAGCCACCACCCGG - Intronic
1184014973 22:41779047-41779069 TACAGGCATGAGCACCCCCCTGG - Intronic
1184042109 22:41950420-41950442 TACAGGCGTGAGCCACCACCTGG - Intergenic
1184085599 22:42261716-42261738 TACAGGTGTGAGCCACCATCTGG - Intronic
1184135382 22:42546029-42546051 TACAGGAATGAGCCGCCACATGG - Intergenic
1184558162 22:45244796-45244818 TACAGGCATGAGCTGCCACATGG + Intergenic
1184566648 22:45296016-45296038 TACAGGCATGTGCCACTGCCTGG - Intergenic
1184700996 22:46172351-46172373 TACAGGCGTGAGCCACTGCCCGG - Intronic
1184745351 22:46452732-46452754 TCTAGGTAGGACCCACCACCAGG - Intronic
1184791322 22:46701903-46701925 GACAGGCGTGAGCCACCGCCCGG - Intronic
1185367322 22:50442688-50442710 TACAGGCATCCGCCACCACCAGG + Intronic
1185396195 22:50590833-50590855 TACAGGTGTGTGCCACCACCTGG + Intronic
1203237535 22_KI270732v1_random:19805-19827 TACAAGCATGAGCCACCATATGG + Intergenic
1203290263 22_KI270735v1_random:30260-30282 TACAAGCATGAGCCACCATATGG - Intergenic
949262027 3:2114175-2114197 TACAGGTGTGAGCCACCACCTGG - Intronic
949307488 3:2659184-2659206 TACAGGTCTGAGCCACCACCTGG - Intronic
949410462 3:3757746-3757768 TACAGGCATGAGCCACCACGTGG + Intronic
949950037 3:9221394-9221416 TACAGGCGTGCACCACCACCAGG - Intronic
950029300 3:9841611-9841633 TATAGGCATGAGCCACCACGCGG + Intronic
951234262 3:20216426-20216448 TACAGGCATGAGCCACTGCGTGG - Intergenic
951245183 3:20332272-20332294 TACAGGCATGAGCCACCGCCTGG + Intergenic
951890282 3:27561953-27561975 AACAGGCATGAGCCACAGCCAGG + Intergenic
952122314 3:30260181-30260203 TACAGGCGTGAGCCACCGCGTGG + Intergenic
952142303 3:30493613-30493635 TACAGGCGTGAGCCGCCACCTGG + Intergenic
952944430 3:38468153-38468175 TATGGGCATGAGCCACCATGCGG + Intronic
953043960 3:39279015-39279037 TATAGGCATGTACCACCGCCCGG - Intronic
953997480 3:47531207-47531229 TACAGGCATGAGCCACTGCGAGG + Intergenic
954030081 3:47812938-47812960 TACAGGCGTGAGCCACCAGCAGG + Intronic
954071541 3:48146482-48146504 TACAGGTGTGAGCCGCCACCTGG + Intergenic
954205980 3:49059238-49059260 TACAGGCGTGAGCCATCACAAGG + Intronic
954268735 3:49490843-49490865 TACAGACATGAGCCACAACCTGG + Intronic
954270793 3:49507073-49507095 TACAGGCATGAGCCACTGCCAGG - Intronic
954406098 3:50345767-50345789 TTTAGGCGCGAGCCACCTCCAGG - Exonic
954770465 3:52963268-52963290 TACAGGCATGACCCACCGCCCGG + Intronic
954815639 3:53278325-53278347 TACAGGCGTGATCCACCGCCCGG - Intergenic
954956627 3:54526964-54526986 TACAGGTGTGAGCCACCACGTGG + Intronic
955184126 3:56698995-56699017 CACAGGCATGCACCACCACCCGG + Intergenic
955283109 3:57613254-57613276 TACAGGCGTGAGCCACTGCCTGG + Intergenic
955376367 3:58400633-58400655 TATAGGCATGAGCCACTGCCCGG - Intronic
955659805 3:61286030-61286052 TACAGGAGTGAGCCACCAACTGG - Intergenic
955683735 3:61528928-61528950 TACAGGCCTGAGCCACCACTGGG - Intergenic
955742959 3:62111722-62111744 TATAGGCGTGAGCCACCACCGGG + Intronic
955873791 3:63468528-63468550 TACAGGCGTGAGCCACCACGTGG - Intronic
955916873 3:63915208-63915230 TACAGGTGTGAGCCACCGCCTGG + Intronic
956746989 3:72318180-72318202 TACAGGCATGAGCCACCGTCCGG - Intergenic
956882340 3:73523300-73523322 TATAGGCATAAGCCACCATACGG + Intronic
957281551 3:78156405-78156427 TATAGGCGTGAGCCCGTACCCGG - Intergenic
957577195 3:82023874-82023896 TTCAGGCATGAGCCGCCAGCTGG + Intergenic
958734709 3:97995117-97995139 TACAGGCATGCACCACCACCTGG + Intronic
959035398 3:101357274-101357296 TACAGGCGTGAGCCACCGCGAGG + Intronic
959383569 3:105673342-105673364 TACAGGCATGAGCCTGTACCTGG + Intronic
959489205 3:106967290-106967312 TACAGGCGTGAGCCACCGCATGG + Intergenic
959527319 3:107391602-107391624 TACAGGCATGAGCCACCACCAGG + Intergenic
959904107 3:111691950-111691972 TTCAGGCAAGAGCCCCCACCAGG + Intronic
959904168 3:111692316-111692338 TACAGGCGTGAGCCACCGCCCGG + Intronic
960134387 3:114090892-114090914 TATAGGCATGAGCCAGCGCACGG - Intergenic
960727728 3:120687421-120687443 TATAGGCGTGAGCCAGCACCTGG + Exonic
961242871 3:125427309-125427331 TACAGGCGTGAGCCACCATGTGG + Intergenic
961687211 3:128642416-128642438 TACAGGTATCAGCCACTACCTGG - Intronic
962365751 3:134778833-134778855 TACAGGCGTGAGCCACCGCGCGG + Intronic
962561912 3:136615501-136615523 TACAGGCGTGAGCCACCGACCGG - Intronic
962584320 3:136826310-136826332 TACAGGCATGAGCCACCACGAGG + Intronic
963005973 3:140726519-140726541 TATAGACATGAGCCAGAACTGGG + Intergenic
963238111 3:142975122-142975144 TACAGGCAAGTGCCACCACCTGG - Intronic
963369236 3:144377099-144377121 TACAGGCGTGAGCCACCGCGCGG - Intergenic
963739927 3:149067866-149067888 TATAGGTGTGAGCCACCAGCAGG - Intronic
963785442 3:149530070-149530092 TACAGGTGTGAGCCACCGCCCGG - Intronic
963891383 3:150639455-150639477 TACAGGCATGAGTCACCATCTGG - Intergenic
963918279 3:150881105-150881127 TACAGGCGTGAGCCACTGCCTGG - Intronic
963946589 3:151152375-151152397 TACAGGTGTGAGCCACCGCCTGG + Intronic
964073677 3:152666800-152666822 TGTAGGCATCCACCACCACCTGG - Intergenic
964356806 3:155858702-155858724 TACAGGCGTGAGCCACCGCCCGG - Intergenic
964437668 3:156671627-156671649 TACAGGCATGAGCCACTGCGTGG + Intergenic
964795817 3:160496010-160496032 TGCAGGCGTGAGCCACCGCCTGG - Exonic
965030475 3:163359170-163359192 TACAGGCACGTGCCACCACCTGG - Intergenic
965125855 3:164628025-164628047 TACGGGAATGAGCCACCACACGG - Intergenic
965295715 3:166943128-166943150 TACAGGCATGCGCCACCAGCAGG - Intergenic
965527662 3:169738773-169738795 TACAGGCGTGAGCCACCACCTGG + Intergenic
965558002 3:170037600-170037622 TACAGGCATGAGCCACCGCCTGG + Intergenic
965952812 3:174331447-174331469 TACAGGCACATGCCACCACCTGG + Intergenic
965977458 3:174642032-174642054 TACAGGCATGAGCCACTGCCGGG + Intronic
965996775 3:174892779-174892801 TACAGGCACATGCCACCACCTGG - Intronic
966022577 3:175233711-175233733 CACAGGCATGAGCTACCACAAGG + Intronic
966088764 3:176104480-176104502 TACAGGCACGTGCCACCACGCGG + Intergenic
966430808 3:179830070-179830092 TACAGGCTTGAGCCACCGCCCGG + Intronic
966568240 3:181408009-181408031 TACAGGCATGAGCCACCGCCAGG - Intergenic
966893547 3:184425834-184425856 TACAGGCACGTGCCACCACACGG + Intronic
966981542 3:185140671-185140693 TCCAGGCGTGAGCCACCGCCTGG - Intronic
967012799 3:185452510-185452532 TACAGGCATGAGCCATTGCCTGG + Intronic
967022078 3:185531603-185531625 TACAGGTGTGAGCCACCAGCTGG - Intronic
967033134 3:185626932-185626954 TACAGGCATGCACCACCACGTGG - Intronic
967880486 3:194297919-194297941 TACAGGAGTGAGCCACCACGTGG + Intergenic
967909359 3:194528329-194528351 TAAAGGCATGAGCCACCGCGTGG + Intergenic
968022314 3:195404063-195404085 TATAGGAATGAGCCACCGTGCGG - Intronic
968109896 3:196036130-196036152 TACAGGCCTGAGCCACCATGCGG + Intronic
968110782 3:196044909-196044931 TACAAGCGTGAGCCACCGCCCGG - Intronic
968123371 3:196141754-196141776 TACGGGCGTGAGCCACCACGCGG - Intergenic
968192091 3:196675925-196675947 GACAGGCGTGAGCCACCACCTGG + Intronic
968264995 3:197355967-197355989 TCCAGGCATGAGGCAACACCTGG - Intergenic
968748805 4:2375498-2375520 AGTGGGCATGAGCCAGCACCTGG - Intronic
968784776 4:2612224-2612246 TACAGGCGTGAGCCACGGCCCGG - Intronic
968804875 4:2765945-2765967 TACAGGTGTGAGCCACCGCCTGG + Intergenic
968821782 4:2858709-2858731 TACAGGCATGAGCCACTGCCTGG - Intronic
968841408 4:3009145-3009167 TATAGGCGTGAGCCACCACCCGG - Intronic
969057495 4:4410996-4411018 TATAGGTGTGCGCCACCACCCGG + Intronic
969381895 4:6806457-6806479 TACAGGCATGAGCCACCGCCAGG - Intronic
969648849 4:8451041-8451063 TACAGGCTTGAGCCACTGCCCGG + Intronic
969832006 4:9805421-9805443 TACAGGCATGAGCCACCTCAGGG - Intronic
969939916 4:10721899-10721921 TACAGGCATGAGCCACTGCCTGG - Intergenic
970388371 4:15580360-15580382 TACAGGCATGAGCCACTGCCTGG - Intronic
970992967 4:22234637-22234659 TACAGGCGTGAGCCACCGCCTGG + Intergenic
971311993 4:25533077-25533099 TACAGGCATGAGCCACTGCCCGG + Intergenic
971330669 4:25678654-25678676 CACAGGCGTGAGCCACCACCAGG + Exonic
971390702 4:26182772-26182794 TACCGGTGTGAGCCACCACCCGG + Intronic
971421809 4:26480782-26480804 TACAGGCATGTGCTACCATCTGG - Intergenic
972433348 4:39006169-39006191 TACAGGCATGAACCACTGCCTGG + Intronic
972454463 4:39239896-39239918 TACAGGCATGAGCCACCACTGGG - Intronic
972780249 4:42280874-42280896 TACCGGCGTGAGCCACCACCTGG + Intergenic
973220047 4:47715462-47715484 TACAGGCATCTGCCACCACACGG - Intronic
973271015 4:48263436-48263458 TACAGGTGTGAGCCACCGCCTGG - Intronic
973325029 4:48851531-48851553 TACAGGCATGCGCCACCACTTGG - Intronic
973332897 4:48927752-48927774 CACAGGCATGAGCCACCATGTGG - Intergenic
974073282 4:57145254-57145276 TATAGGCATGCACCACCACATGG + Intergenic
974110298 4:57518136-57518158 TACAGGCATGAGCCACTATCTGG - Intergenic
974297831 4:60025577-60025599 TACAGGTGTGAGCCACCACCTGG + Intergenic
975542438 4:75528771-75528793 TACAGGTATGAGCCACCACCCGG - Exonic
975705019 4:77103164-77103186 TATAGGTGTGAGCCACCACGCGG + Intergenic
976761460 4:88553809-88553831 TACAGGCATGAGCCACTGCGCGG + Intronic
976761592 4:88555008-88555030 TACAGGCATGAGCCACTGCACGG - Intronic
977298104 4:95233658-95233680 TACAGGCCTGAGCCACCACATGG - Intronic
977537912 4:98277949-98277971 TACAGGCGTAAGCCACCACTTGG - Intronic
977582550 4:98741675-98741697 TACAGGCATGAACCACTGCCTGG - Intergenic
977924146 4:102681024-102681046 TATAGGCATGAGCCACTGCCTGG - Intronic
977937360 4:102822658-102822680 TACAGGCGTGAGCCACCACGTGG - Intronic
977939636 4:102844743-102844765 TACAGGCGTGACCCACCGCCCGG - Intronic
978002279 4:103571169-103571191 TACAAGCGTGAGCCACTACCTGG - Intergenic
978178285 4:105761277-105761299 TATAGGCTTCAGCCACCACTCGG + Intronic
978446197 4:108782360-108782382 TACAGGTATGAGCCACCTGCCGG + Intergenic
978515493 4:109564270-109564292 TACAGGCATGTGCCACCATGGGG + Intronic
978992800 4:115106877-115106899 CATAGGCATGAGCCACTGCCTGG - Intronic
979140625 4:117169331-117169353 GACAGACATGAGCCACTACCCGG + Intergenic
979252370 4:118578847-118578869 TACAGGCATGGGCCACTGCCCGG + Intergenic
979258399 4:118627419-118627441 TAGAGGTATGTGCCACCACAAGG + Intergenic
979329952 4:119413140-119413162 TAGAGGTATGTGCCACCACAAGG - Intergenic
979864612 4:125738071-125738093 TACAGGCGTGAGCCACCATGTGG - Intergenic
979906790 4:126303602-126303624 TATTTGAATGAGCAACCACCTGG - Intergenic
980018051 4:127676308-127676330 TATAGGTGTGAGCCACTGCCTGG - Intronic
980041466 4:127945456-127945478 TACAGGCATGTGCCACCACGTGG + Intronic
980124998 4:128765740-128765762 TACAGGCATGAGCCACCCTGGGG - Intergenic
980518364 4:133895806-133895828 TATAGGCAAGAGCCTCCATACGG + Intergenic
980812182 4:137896212-137896234 TACAGGCATGAGCCATCACGCGG - Intergenic
981785666 4:148476882-148476904 TACAGGCGTGCGCCACCGCCAGG - Intergenic
982002444 4:151033245-151033267 TATAGGCATGAGACACTGCGTGG + Intergenic
982010052 4:151097882-151097904 TACAGGCATGAGCCACCACCTGG + Intergenic
982200942 4:152959674-152959696 TACAGGCATGAGTCACTACCTGG + Intronic
982356904 4:154480901-154480923 TACAGACATGAGCCACTGCCTGG + Intronic
982528620 4:156509694-156509716 TACAGGCATGTGCCACCACACGG - Intergenic
982671321 4:158323414-158323436 TATAGGCATATGCCACCACGCGG + Intronic
982989310 4:162250627-162250649 TACAGGCGTGAGCCACCGCCTGG - Intergenic
983098468 4:163595091-163595113 TACAGGCATGAGCCACTCGCTGG - Intronic
983098483 4:163595234-163595256 TACAGGCATGAGCCACTCACTGG - Intronic
983114972 4:163803446-163803468 TATAGGCATGAGCCACTGCCCGG + Intronic
983335636 4:166388410-166388432 TATAGGCGTGAGCCACCGTGCGG + Intergenic
983565439 4:169145721-169145743 TACAGGTGTGAGCCACCGCCTGG + Intronic
983565479 4:169146501-169146523 TACAGGTGTGAGCCACCACCCGG + Intronic
983670932 4:170237088-170237110 TATAGGCACGTGCCACCACCCGG - Intergenic
983796348 4:171868820-171868842 TACAGGCGTGGGCCCCCACCTGG + Intronic
983813694 4:172096368-172096390 TATAGGCATGAGCCACTGCCGGG + Intronic
984091959 4:175386595-175386617 TATAGGCGTGCAGCACCACCAGG - Intergenic
984262076 4:177454036-177454058 TACAGGCGTGAGCCACCGCCTGG + Intergenic
984742390 4:183178263-183178285 TATAGGCATCAGCCACTCTCTGG - Intronic
986689269 5:10300522-10300544 TACAGGCCTGAGCCACCATGCGG - Intronic
987318037 5:16742542-16742564 TATAGGCGTGAGCCACCATGCGG - Intronic
987364668 5:17138224-17138246 TACAGGCGTGAGCCACCGCCTGG + Intronic
987368194 5:17168886-17168908 TATAGGTGTGAGCCTGCACCTGG + Intronic
987378516 5:17260898-17260920 TACAGGTGTTAGCCACCACCAGG - Intronic
987389929 5:17366381-17366403 TAGAGGCGTGAGCTACCACGGGG - Intergenic
987439563 5:17939695-17939717 TACAGGCATGAGCCACTGCCCGG + Intergenic
987664474 5:20919424-20919446 TACAGGTGTGAGCCACCACCCGG - Intergenic
987798407 5:22660691-22660713 TACAGGCATGAGCCACTGCCTGG + Intronic
988452662 5:31358905-31358927 TACAGGCGTGCGCCACCACGCGG + Intergenic
988528408 5:32006650-32006672 TACAGGCATGAACCACTGCCAGG + Intronic
988545067 5:32148520-32148542 TACAGGCGTGAGCCACCATGTGG - Intronic
988557145 5:32247072-32247094 TATAGGCATGAGCCGCTGCCTGG - Intronic
988748929 5:34175318-34175340 GACAGGCATGAGCCACCATGCGG + Intergenic
988758207 5:34282768-34282790 TACAGGCGTGAGCCACCACCCGG + Intergenic
988983570 5:36595666-36595688 TACAGGCAAGAGCCGCCACACGG - Intergenic
989024500 5:37050968-37050990 TACAGGTGTGCGCCACCACCTGG + Intronic
989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG + Intronic
989657328 5:43759046-43759068 TATAGGCATGAGCCAGTGCCCGG + Intergenic
990059500 5:51630080-51630102 TACAGGCATGAGCCACTGGCCGG - Intergenic
990539567 5:56758597-56758619 TACAGGCGTGAGCCACCGCCTGG - Intergenic
991982647 5:72249406-72249428 TACAGGCGTGAGCCACCACGCGG - Intronic
992330005 5:75706824-75706846 TACAAGCATGAGCCACTGCCTGG + Intronic
992713241 5:79482720-79482742 TACAGGTATGAGCTACCACCTGG - Intronic
992747947 5:79837387-79837409 TACAGGCATGAGCCACCCACTGG + Intergenic
992906782 5:81354965-81354987 TATAGGCATAAGCCACCGCCAGG + Intronic
993178886 5:84523183-84523205 TACAGGCATAAGCCACCACATGG - Intergenic
993387189 5:87273971-87273993 TACAGGCGTGAGCCACCTCGCGG + Intronic
994249809 5:97522379-97522401 TACAGGCATGAGCCACTGCTTGG + Intergenic
994327562 5:98466385-98466407 TACAGGCCTGAGCCACCGCCTGG - Intergenic
994697425 5:103090011-103090033 TACAGGCATGAGCCACTGCCTGG - Intronic
994702327 5:103150628-103150650 TACAGGTGTGAGCCACCACAAGG - Intronic
995792082 5:115899561-115899583 TACAGGTGTGAGCCACCACCTGG + Intronic
997118958 5:131154812-131154834 TACAGGCGTGAGCCCACACCTGG + Intergenic
997200455 5:132006899-132006921 TATTGGCATCATCCCCCACCTGG + Intronic
997543339 5:134683161-134683183 TATAGGCGCGAGCCAACACCTGG + Intronic
997566531 5:134891647-134891669 TACAGGTATGAGCAACCACAGGG - Intronic
997943200 5:138177110-138177132 TACAGGCGTGAGCCACTGCCAGG - Intronic
997994870 5:138577402-138577424 TACAGGCGTGAGCCACCGCCTGG - Intergenic
998046424 5:138990701-138990723 TAGAGGCATGAGCCCCAAACAGG + Intronic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
998357925 5:141556830-141556852 TACAGGCATGCGCCACCAGGCGG + Intronic
998772908 5:145566562-145566584 TACAGGCATGAACCACCATGTGG - Intronic
998948087 5:147362804-147362826 TACAGGCATGAGCCAGTGCCTGG - Intronic
998968927 5:147570226-147570248 TACAGGCGTGAGCCACCGCCTGG + Intergenic
999168088 5:149568549-149568571 TACAGGCATCAGTCACCACGCGG - Intronic
999199273 5:149804529-149804551 TACAGGCATGCTCCACCACCTGG - Intronic
999214986 5:149925429-149925451 TACAGGCGTGAGCCACTGCCTGG - Intronic
999457617 5:151730844-151730866 TACAGGCAGGTGCCACCACCTGG + Intergenic
999481058 5:151948564-151948586 TGTAGTCATGGGCCACCACCAGG - Intergenic
999603222 5:153289880-153289902 TCCAGGCATGAGCCACCACATGG + Intergenic
1000001328 5:157141864-157141886 TACAGGCGTGAGCCACCACACGG + Intronic
1000298580 5:159934523-159934545 TATAGGAGTGAGCCACCACCTGG - Intronic
1000332964 5:160220332-160220354 TACAGGTGTGAGCCATCACCTGG - Intronic
1000771252 5:165357837-165357859 TACAGGCGTGTGCTACCACCCGG + Intergenic
1000791250 5:165609971-165609993 TATAGGCATGAGCCACCGCACGG + Intergenic
1000924785 5:167180248-167180270 TACAGGCATGTGCCACCACACGG + Intergenic
1001387349 5:171350790-171350812 TACAGGCGTGAGCCACCACCTGG + Intergenic
1001502165 5:172245569-172245591 TACAGGCATGCGCCACCACGTGG - Intronic
1001607325 5:172970909-172970931 TACAGGCCTGCGCCACCACGGGG + Intergenic
1002042713 5:176526472-176526494 TACAGGCATGAGCCACCGGCTGG + Intergenic
1002358653 5:178652080-178652102 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1002498334 5:179631334-179631356 TATAGGCATGAGCCACCACACGG - Intronic
1002499087 5:179635612-179635634 TATAGGCGTGAGCCACTGCACGG - Intergenic
1002502589 5:179656911-179656933 TATAGGCGTGAGCCACTGCACGG + Intergenic
1002728965 5:181321027-181321049 TCGAGGCATGTGCCACCACAAGG + Intergenic
1003334193 6:5155220-5155242 TACAGGCATGCGCCACCGCCTGG + Intronic
1003355850 6:5369083-5369105 TGTAGACATCACCCACCACCAGG - Exonic
1003508138 6:6756750-6756772 CAAAGGCATGACCCACCATCAGG + Intergenic
1003522029 6:6866278-6866300 TACAGGCGTGAGCCACCATGCGG + Intergenic
1003597421 6:7486743-7486765 TACAGGCGTGAGCCACCACGCGG + Intergenic
1003603419 6:7539416-7539438 TACAGGCATGAGCCACCGCACGG + Intergenic
1003977525 6:11357972-11357994 TACAGGCGTGAGCCACCATGCGG - Intronic
1004328753 6:14701673-14701695 TACAGGCGTGAGCCACCACATGG + Intergenic
1004402005 6:15297410-15297432 TACAAGCATGAGCCACCGCCCGG + Intronic
1004411939 6:15389298-15389320 TATAGGCACGTGTCACCGCCTGG + Intronic
1004657786 6:17681309-17681331 TACAGGCATGAGCCGCCTTCTGG - Intronic
1004870711 6:19901250-19901272 TTCAGGTATGAGCCACCAGCTGG + Intergenic
1004992026 6:21149278-21149300 TACAGGCATGCCCCACCTCCAGG + Intronic
1005045998 6:21643080-21643102 TATAGGCATGAGCCACCGCCTGG - Intergenic
1005074774 6:21896330-21896352 TACAGGCATGAGCCACCATGCGG - Intergenic
1005384799 6:25275253-25275275 TATAGGTGTGTGCCACCACATGG - Intergenic
1005516981 6:26564346-26564368 TACAGGCGTGAGCCACCACTGGG - Intergenic
1005561870 6:27048710-27048732 TACAGGTGTGAGCCACCATCTGG + Intergenic
1005620475 6:27615320-27615342 TACAGGCATGAGCCACCACCCGG + Intergenic
1005645480 6:27833865-27833887 TACAGGCATGTGACACCACCTGG - Intergenic
1006103860 6:31704092-31704114 TACAGGCATGAGCCATGGCCTGG - Intronic
1006293692 6:33160252-33160274 TACAGGCGTGAGCCACCGCGTGG - Intergenic
1006398731 6:33803579-33803601 TACAGGCATGAGCCACTGCAGGG + Intronic
1006651638 6:35556571-35556593 TATAGGCATATGCCACCACACGG + Intergenic
1006686521 6:35839289-35839311 TACAGGCCTGAGCCACCACCTGG + Intronic
1006769330 6:36539108-36539130 TACAGGCATGAGCCACTGCTTGG - Intronic
1006858444 6:37152809-37152831 TACAGGCATGAGCCACCGCACGG - Intergenic
1006891766 6:37434749-37434771 TACAGGCATGTGCCACCACCCGG + Intronic
1007183009 6:39944129-39944151 TACAGGCATGAGCCACCGGGAGG - Intergenic
1007526510 6:42499624-42499646 TACAGGCATGAGCCACCTTGAGG + Intergenic
1007549340 6:42717080-42717102 TACAAGCATGAGCCCGCACCTGG + Intronic
1007574119 6:42913900-42913922 CACAGGCGTGCGCCACCACCTGG - Intergenic
1007643481 6:43362645-43362667 TACAGGCATGCGCCACCACTGGG + Intronic
1007850961 6:44802421-44802443 TATAGGTGTGAGCCTGCACCTGG + Intergenic
1008330162 6:50235743-50235765 TACAGGCATGTGCCACCACACGG - Intergenic
1008908439 6:56706723-56706745 TACAGGTATGAGCCACCACATGG - Intronic
1009528689 6:64781434-64781456 TACAGGCGTGAGCCACCGCCCGG - Intronic
1010188079 6:73165667-73165689 TACAGGCGTGAACCACCACATGG - Intronic
1010228630 6:73514919-73514941 TACAGGCGTGAGCCATGACCTGG + Intergenic
1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG + Intergenic
1012343617 6:98158366-98158388 TACAGGCATGAGCCACCGGTCGG - Intergenic
1012387441 6:98698455-98698477 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1012892962 6:104918135-104918157 TACAGGCATGAGCCACTGCACGG - Intergenic
1012903257 6:105032447-105032469 TAAAGGTGTGAGCCACCACACGG - Intronic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013083800 6:106837611-106837633 TGCAGGCATGTACCACCACCTGG + Intergenic
1013129013 6:107213614-107213636 TACAGGCACCTGCCACCACCCGG - Intronic
1013213484 6:108007025-108007047 TACAGGTGTGAGCCACCGCCTGG + Intergenic
1013215682 6:108025251-108025273 TACAGGCATGAGCCACTGCATGG + Intergenic
1013238773 6:108223775-108223797 TACAGGCCTGAGCCACTGCCTGG + Intronic
1013298220 6:108779184-108779206 TACAGGCGTGAGCCACCACCTGG - Intergenic
1013398960 6:109772595-109772617 TACAAGCATGTGCCACCACCTGG + Intronic
1014043445 6:116855728-116855750 TACAGGCATGAGCCACCACACGG - Intergenic
1014154469 6:118094690-118094712 TACAGACATGAGCCACCACATGG - Intronic
1014216097 6:118754078-118754100 TACAGGCGTGAGCCACCTGCTGG + Intergenic
1014287181 6:119513812-119513834 TAGAGTCATGTGCCACCACACGG - Intergenic
1014966863 6:127764916-127764938 CATTTGTATGAGCCACCACCAGG + Intronic
1015105116 6:129527588-129527610 TACAGGCATGAGCCACCCTTAGG + Intergenic
1015838682 6:137451833-137451855 TACAGGCATATGCCACCGCCTGG + Intergenic
1015951590 6:138558765-138558787 TATAGGCGTGAGCCACTGCCTGG - Intronic
1016561285 6:145397570-145397592 TGTAGGCATCAACCACCACAAGG + Intergenic
1016985464 6:149891609-149891631 TATAGGCATGAGCCACTGTGAGG - Intronic
1017136240 6:151150086-151150108 TACAGGAATGAGCCACCACATGG - Intergenic
1017143802 6:151216006-151216028 TACAGGCATGAGCCACTGCCTGG + Intergenic
1017345258 6:153372146-153372168 TATAGGCATGAGCCACCACCTGG - Intergenic
1017361215 6:153573992-153574014 TACAGGCGTTAGCCACCACGCGG + Intergenic
1017385595 6:153879141-153879163 AATAGGCAGGTGCCACCCCCAGG + Intergenic
1017713938 6:157194842-157194864 TACAGGCATGAGTCATCACCTGG - Intronic
1018249323 6:161852310-161852332 TATAGGCTTGCACCACCACCTGG - Intronic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1018707476 6:166473465-166473487 TATAGGCAGGAGCCACTGCACGG + Intronic
1019004012 6:168781034-168781056 TACAGGCATGAGCCACCAACTGG + Intergenic
1019167071 6:170104216-170104238 TACAGGCATGAGCCACCGCATGG + Intergenic
1019345440 7:527486-527508 TACAGGCGTGAGCCACCACAAGG + Intergenic
1019718899 7:2555960-2555982 TACAGGCATGAGCCACAGCGCGG - Intergenic
1019745111 7:2695439-2695461 TATAAGCCTGAGCCACCACATGG - Intronic
1019947567 7:4342167-4342189 TACAGGCCTGAGCCACCCACAGG - Intergenic
1019978840 7:4606133-4606155 TACAGGCGTGAGCCACCCACCGG - Intergenic
1020025402 7:4896202-4896224 TAAAGGTGTGAGCCACCACCTGG - Intergenic
1020202930 7:6094312-6094334 TACAGGCATGCACCAGCACCTGG + Intergenic
1020229671 7:6308251-6308273 TACAGGCCTGAGCCACCGCCTGG - Intergenic
1020619317 7:10498691-10498713 TACAGGCATGAGCCAGCGCCGGG - Intergenic
1020890271 7:13869468-13869490 TACAGGTGTGAGCCACCACCTGG + Intergenic
1021092085 7:16495872-16495894 TACAGGCGTGCACCACCACCTGG + Intronic
1021354248 7:19634609-19634631 TACAGGCATAAGGCACCACACGG - Intergenic
1021601094 7:22364293-22364315 TATAGGGAGGAGCCCCCATCTGG - Intergenic
1021665134 7:22969439-22969461 TACAGGCATGAGCCAACGTCTGG + Intronic
1021685614 7:23182620-23182642 TACAGGCGTGAGCCACCGCCCGG - Intronic
1021703273 7:23341388-23341410 TATAGGCGTGAGCTATTACCTGG - Intronic
1021705473 7:23363520-23363542 TACAGGCGTGACCCAGCACCTGG + Intronic
1022015329 7:26344442-26344464 TACAGGTGTGAGCCACCACCTGG + Intronic
1022551575 7:31244910-31244932 TACAGGCATGAGCCACTTCCTGG + Intergenic
1022691464 7:32660005-32660027 TACAGTCATGCGCCACCACATGG - Intergenic
1023060208 7:36319468-36319490 TATAGGCGCATGCCACCACCCGG + Intergenic
1023193548 7:37609860-37609882 TACAGGCGTGAGCCACTACCCGG - Intergenic
1023400379 7:39788727-39788749 TAGAGGTATGTGCCACCACAAGG + Intergenic
1023519101 7:41033035-41033057 TACAGGCATGAGCCACTGCGTGG + Intergenic
1023848009 7:44134100-44134122 TACAAGCATGAGCCACTGCCTGG + Intergenic
1023872665 7:44271192-44271214 TACAGGCATGAGCCACCATCTGG + Intronic
1023922734 7:44642138-44642160 TATAGGCATGAGCCACCATCTGG - Intronic
1023967125 7:44968778-44968800 TACAGGCATGAGCGACCTCATGG + Intronic
1024650020 7:51395709-51395731 TAGAGGTATGTGCCACCACAAGG - Intergenic
1024805449 7:53134177-53134199 TACAGGCATGAGCCACCATATGG - Intergenic
1024946223 7:54809742-54809764 TACAGGCATGACCCCACACCTGG + Intergenic
1025051151 7:55736102-55736124 TATAGGCATGAGCCACCACTAGG + Intergenic
1025054166 7:55751376-55751398 TAGAGGTATGTGCCACCACAAGG - Intergenic
1025076746 7:55950520-55950542 TACAGGCATGAGCCACCAGTGGG - Intergenic
1025132217 7:56381537-56381559 TAGAGGTATGTGCCACCACAAGG - Intergenic
1025283489 7:57645012-57645034 TACAGGCATGAGCCAGAGCCTGG + Intergenic
1025296406 7:57778395-57778417 TACAGGCGTGAGCCAGCACCTGG - Intergenic
1025298701 7:57798661-57798683 TACAGTCATTAGCCACCACATGG - Intergenic
1025837731 7:65110923-65110945 TACAAGCATGAGCCACCATATGG + Intergenic
1025885341 7:65585072-65585094 TACAAGCATGAGCCACCATATGG - Intergenic
1025911865 7:65835136-65835158 TAGAGGTATGAGCCACCACAAGG + Intergenic
1025931289 7:65996729-65996751 TACAGGCATGCACCACCACACGG + Intergenic
1025944979 7:66098768-66098790 TACAGGCATGAGCCACGGCCTGG - Intronic
1025946021 7:66105212-66105234 TATAGGCACGTGCCAACAACCGG - Intronic
1025958387 7:66200003-66200025 TACAGGCATGAGCCACTGCGCGG + Intergenic
1025992950 7:66509622-66509644 TATAGGTGTGAGCCACCACATGG - Intergenic
1026004580 7:66591216-66591238 TATAGGCGTGAGCCATCGCGTGG - Intergenic
1026054497 7:66972687-66972709 TATAGGCGTGAGCCACGCCCCGG - Intergenic
1026055214 7:66977756-66977778 TACAGGCCTGAGCCACCGCCTGG + Intergenic
1026066359 7:67076913-67076935 TACAGGCTCGTGCCACCACCTGG + Intronic
1026196513 7:68178131-68178153 TATAGGTGTGTGCCACCACATGG + Intergenic
1026264687 7:68785894-68785916 TGCAGGCATGAGCAACAACCCGG - Intergenic
1026524452 7:71142143-71142165 TATAGGAATGAGCCACTATGCGG + Intronic
1026676150 7:72430094-72430116 TACAGGTGTGAGCCACCGCCCGG + Intronic
1026722479 7:72844101-72844123 TACAGGCCTGAGCCACCGCCTGG - Intergenic
1026917670 7:74131673-74131695 TACAGGCACCAGCCACCACCTGG + Intergenic
1027058568 7:75067351-75067373 TACAGGCATGAGCCACTGCCCGG - Intronic
1027364869 7:77446922-77446944 TACAGGCATGAGCCACCGCCTGG + Intergenic
1027762873 7:82302033-82302055 TATAGGCATGAGCCACCGCCTGG + Intronic
1028413872 7:90559460-90559482 TACAGGCGTGAGCCACCGTCAGG + Intronic
1028438239 7:90829806-90829828 TACAGGCATGAGACACTGCCCGG + Intronic
1028707700 7:93869692-93869714 TACAGGCTTGAGCCAGCGCCTGG + Intronic
1029093522 7:98067228-98067250 TACAGGCAGGAGGCACCACACGG + Intergenic
1029422808 7:100479743-100479765 TACAGGCATGAGCCACCACCGGG - Intergenic
1029462953 7:100706711-100706733 TACAGGCGTGAGCCACTGCCCGG + Intronic
1029479560 7:100804274-100804296 TACAGGCGTGAGCCACCACCTGG + Intronic
1029533811 7:101143787-101143809 TACAGGCATGAGCCACTGCCTGG - Intergenic
1029589973 7:101500906-101500928 TACAGGCGTGAGCCACCGCCCGG - Intronic
1029840146 7:103353580-103353602 TATAGGCAGGAGCCACCGCACGG + Intronic
1030142169 7:106316272-106316294 TACAGGCATGAGCCACCACCTGG - Intergenic
1030871131 7:114757724-114757746 TACAGGCATGAGCCACCGCAGGG + Intergenic
1031593961 7:123626329-123626351 TGCAGGCATGTGCCACCACAGGG - Intronic
1031611788 7:123836751-123836773 TACAGGCATGAGCCACCACCTGG - Intronic
1032050702 7:128648168-128648190 TCGAGGCATGTGCCACCACAAGG + Intergenic
1032052815 7:128659450-128659472 TATAGGTATGAGCCACCACTAGG - Intergenic
1032082672 7:128867843-128867865 TACAGGCATGAGCCACCGGCTGG + Intronic
1032092248 7:128916701-128916723 TACAGGCGCAAGCCACCACCTGG - Intergenic
1032145342 7:129374664-129374686 TACAGGCATGTGCCACCACGCGG - Intronic
1032156626 7:129474785-129474807 TATAGGCCTGAGCCACCGCTGGG + Intronic
1032171890 7:129591752-129591774 CACAGGCATGAGCCACTGCCCGG + Intergenic
1032673829 7:134109865-134109887 TACAAGCATGAGCCACTGCCTGG + Intergenic
1032748129 7:134808381-134808403 TACAGGCATGAGCCACCACCTGG + Intronic
1033165715 7:139036736-139036758 TACAGGCGTGAGCCACCCCGCGG + Intergenic
1033195747 7:139325913-139325935 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1033358570 7:140621308-140621330 TACAGATGTGAGCCACCACCAGG + Intronic
1033651149 7:143345025-143345047 TACAGGCGTGAGCCACCGCCTGG + Intronic
1033668650 7:143468385-143468407 TACACGCATGAGCCACTACAAGG - Intergenic
1034006838 7:147482441-147482463 TACAGGCGTGAGCCACCACACGG - Intronic
1034154277 7:148942036-148942058 TACAGGCGTGAGCCACCAGGAGG - Intergenic
1034173884 7:149085315-149085337 TACAGGTATGAGCCAGTACCTGG - Intronic
1034181657 7:149143669-149143691 TACAGGCATGCGCCACCATGGGG - Intronic
1034495741 7:151421057-151421079 TATAGACATGAGCACCCACCTGG + Intergenic
1034584320 7:152075653-152075675 TACAGGCATGCGCCACCCCACGG - Intronic
1034631716 7:152536174-152536196 TACAGGCGTGAGCCACCACCCGG - Intergenic
1034694038 7:153038495-153038517 TACAGGCATGAGCCACCCCTTGG + Intergenic
1035123493 7:156590014-156590036 TTTAGGCATAAGCTACCACTGGG - Intergenic
1035673463 8:1437690-1437712 TACAGGCATGAGCCACCGGCCGG - Intergenic
1036093420 8:5695541-5695563 CACAAGCATGAGCCACCACATGG - Intergenic
1036225617 8:6955137-6955159 TACAGGCGTGAGCCACCTGCCGG + Intergenic
1036485443 8:9174848-9174870 TACAGGCGTGAGCCTCAACCCGG + Intergenic
1036810583 8:11865732-11865754 TACAGGCATGAGCCACCGCGCGG - Intronic
1036932309 8:12968158-12968180 TACAGACATGAGCCACCACCTGG + Intronic
1037084930 8:14836775-14836797 TACAGGCATGAGCCACATCCTGG + Intronic
1037099381 8:15024659-15024681 TACAGGCTTGAGCCACCACCCGG - Intronic
1037100621 8:15040337-15040359 TACAGGCGTGAGCCACCTCGCGG - Intronic
1037253665 8:16926515-16926537 TACAGGCGTGAGCCACCGTCTGG - Intergenic
1037621932 8:20571563-20571585 TACAGGCATGAGACACTGCCTGG + Intergenic
1037912156 8:22749945-22749967 TACAGGCATGTGCCACCATGTGG + Intronic
1037997213 8:23361565-23361587 TACAGGCGTGAGCCACTGCCTGG - Intronic
1038186789 8:25282581-25282603 TACAGGCGTGAGCCACTAGCTGG - Intronic
1038330741 8:26607207-26607229 AACAGGCGTGAGGCACCACCCGG - Intronic
1038550609 8:28465345-28465367 TACAGACATGAGCCACCACACGG - Intronic
1038575124 8:28698571-28698593 TACAGGCGTGAGCCACCACGCGG - Intronic
1038634853 8:29277508-29277530 TACAGGCATGAGCCACCACCTGG + Intergenic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1039042910 8:33425058-33425080 TACAGGTGTGAGCCAGCACCCGG - Intronic
1039214453 8:35253762-35253784 TATAGGTGTGAGCCACCACGTGG + Intronic
1039507871 8:38065103-38065125 TAAAGGCATGAGCCACAGCTCGG + Intergenic
1039892262 8:41693698-41693720 TACAGGCGTGAGTCACCACATGG + Intronic
1039964947 8:42277456-42277478 TACAGGCATGAGTCACTAACAGG + Intronic
1040504705 8:48036708-48036730 TACAGGCATGAGCCACTGCCTGG + Intronic
1040507417 8:48062314-48062336 TAGCGGCATGAGCCACCACATGG - Exonic
1040593277 8:48815753-48815775 TACAGGCACGTGCCACCACGTGG - Intergenic
1041038850 8:53825310-53825332 TACAGGCATGAGCTACTGCCAGG + Intronic
1041761830 8:61375524-61375546 TACAGGCTTTAGCCACCGCCTGG + Intronic
1042180278 8:66080587-66080609 CATAGGCCTGAGCAAGCACCAGG + Intronic
1042230160 8:66546412-66546434 TACAGGCATGAGCCACTCTCTGG + Intergenic
1042289241 8:67150674-67150696 TACAGGCGTGAGCCATCGCCTGG + Intronic
1042386174 8:68177422-68177444 TATAGGCATGTGCCCCCATGGGG - Intronic
1042395267 8:68284976-68284998 TACAAGCATGTGCCACCACGCGG - Intergenic
1042511404 8:69616358-69616380 TATAGGCATGCGCCGCCACCTGG + Intronic
1042581844 8:70288301-70288323 TACAGGCATGAGCCACACACCGG - Intronic
1043097191 8:75990099-75990121 TACAGGCATGAGCCACCACCTGG - Intergenic
1043427260 8:80159913-80159935 TACAGGTATGAGCCACTGCCTGG - Intronic
1043443777 8:80299845-80299867 TACAGGCATGAGCCTGCGCCCGG + Intergenic
1044555592 8:93558782-93558804 TACAGGCGTGAGCCACCGCGTGG + Intergenic
1044585857 8:93868741-93868763 TACAGGCGTGAGCCACCGCTTGG + Intronic
1044968736 8:97599202-97599224 TATAGGTATGAGCCACACCAGGG - Intergenic
1044992426 8:97807961-97807983 TATAGGTATGTGCCATCACATGG + Intronic
1045011292 8:97961088-97961110 TACAGGCGTGAGCCACCGCATGG + Intronic
1045225865 8:100245046-100245068 TACAGGCACCTGCCACCACCCGG + Intronic
1045458624 8:102407407-102407429 TACAGGCATGAGCCACTGGCCGG + Intronic
1045461928 8:102432784-102432806 TACAGGCATGAGTCACTGCCTGG + Intergenic
1045506134 8:102780038-102780060 TACAGGCATGAGCCACCGCGCGG - Intergenic
1045530744 8:102982996-102983018 TACAGGCATGTACCACCATCTGG - Intergenic
1045625817 8:104049145-104049167 TACAGGCGTGAGCCACCGCCCGG - Intronic
1046855990 8:119032624-119032646 TACAGGCATGAGCCACCGCGCGG - Intronic
1047094321 8:121607654-121607676 TACAGGCGTGAACCACCGCCTGG + Intergenic
1047240514 8:123083531-123083553 TACAGGCGTGAGCCACCGCCCGG + Intronic
1047323068 8:123807366-123807388 TACAGGCATGAGCCTGTACCTGG - Intronic
1047375456 8:124291834-124291856 TGCAGGCATGAGCCACCGCCCGG - Intergenic
1047412950 8:124639059-124639081 TACAGGCATGAGCCACCACCTGG - Intronic
1047493693 8:125394570-125394592 TACAGGCGTGAGCCACTGCCTGG - Intergenic
1048010364 8:130450494-130450516 TATAGGTGTGAGCCACCACACGG + Intergenic
1048396424 8:134018555-134018577 TACAGGCATGAGCCACCATATGG - Intergenic
1049729727 8:144170106-144170128 TACAGGCGTGAGCCACTACCTGG + Intronic
1049735261 8:144201735-144201757 TACAGGCGTGAGCCACTGCCCGG - Intronic
1049775590 8:144402578-144402600 TACAGGCGTGAGCCACCTCAAGG + Intronic
1050110203 9:2207612-2207634 TACAGGCATGCGCCACCACATGG + Intergenic
1050436880 9:5620358-5620380 TACAGGTATGAGCCACCACATGG + Intergenic
1050536081 9:6631923-6631945 TACAGGCATGTGCTACCACATGG - Intronic
1050760749 9:9067100-9067122 TACAGTCATGTGCCACCACGAGG - Intronic
1050767295 9:9150747-9150769 TACAGGCATGAGCCAACAACCGG + Intronic
1050794840 9:9525130-9525152 TACAGGCGTGAGCCACCGCCCGG + Intronic
1051103157 9:13546129-13546151 TACAGGTGTGAGCCACCACCCGG - Intergenic
1051408019 9:16759996-16760018 TACAGGCGTGAGCCACCGCGCGG + Intronic
1051463313 9:17348669-17348691 TATAGGCATGCGTCACCACGCGG + Intronic
1051679047 9:19588683-19588705 TACAGGCATGAGCCACCACGCGG - Intronic
1052152022 9:25128865-25128887 TACAGGTGTGAGCCACCGCCCGG + Intergenic
1052814694 9:33092433-33092455 TATAGGCATGAGCCACCTCGTGG + Intergenic
1052828596 9:33196343-33196365 TACAGGCGTGAGCCAACACCTGG - Intergenic
1052905314 9:33828527-33828549 TACAGGCATGTGCCACCACCGGG + Intronic
1052932395 9:34066447-34066469 TACAGACATGAGCCACTGCCTGG - Intergenic
1052932918 9:34070417-34070439 TACAGGCATGAGCCACTGCCCGG - Intergenic
1053215499 9:36266923-36266945 TACAGGCGGGGGCCACCACCCGG - Intronic
1053260265 9:36656890-36656912 TACAGGCATGAGCCACCATGGGG + Intronic
1053292949 9:36894082-36894104 TATAGGCATGTACCAAAACCAGG - Intronic
1053395741 9:37772554-37772576 TATAGGCATGAGTCCTCATCTGG + Intronic
1053794898 9:41717360-41717382 TACAGTCATTAGCCACCACGTGG + Intergenic
1054183307 9:61929423-61929445 TACAGTCATTAGCCACCACGTGG + Intergenic
1054655199 9:67659051-67659073 TACAGTCATTAGCCACCACGTGG - Intergenic
1054784832 9:69200667-69200689 TATAGGCTTGAGCCACCATGGGG + Intronic
1055036423 9:71823148-71823170 TATAGGCAAGAGTCACCACCTGG + Intergenic
1055067781 9:72135884-72135906 TACAGGCATGAGCCACCACGCGG + Intronic
1055092978 9:72381352-72381374 TACAGGCATGTACCACCACATGG - Intergenic
1055095941 9:72414250-72414272 TACAGGCATGCACCACCGCCAGG - Intergenic
1055302741 9:74899228-74899250 TACAGGCATGATCTACCACGTGG - Intergenic
1055416895 9:76093233-76093255 TAGAAGCATGCACCACCACCCGG + Intronic
1055438452 9:76315905-76315927 TACAGGCATGAGCCACTTCAAGG + Intronic
1055771766 9:79724563-79724585 TACAGGCATGAGCCACCACGTGG - Intronic
1055959738 9:81808994-81809016 TACAGGCATGAACAACTACCCGG - Intergenic
1056050762 9:82766431-82766453 TACAGGCGTGAGCCACCGCGTGG - Intergenic
1056290025 9:85133926-85133948 TACAGGTGTGAGCCACTACCTGG - Intergenic
1056407603 9:86290564-86290586 TACAGGCATGAGCCACCGCCTGG - Intronic
1056521987 9:87410257-87410279 TCCAGGCATGAGCCACCCACTGG + Intergenic
1057017608 9:91666366-91666388 TACAGGCCAGAGCCACCACCTGG + Intronic
1057122289 9:92587192-92587214 TACAGGCGTGAGCCACCGTCCGG - Intronic
1057124641 9:92607382-92607404 TACAGCCATAAGCAACCACCAGG - Intronic
1057159785 9:92881332-92881354 TACAGGCATGAGCCACCGCATGG - Intergenic
1057210322 9:93197796-93197818 TATAGGCATGAGCCACTGCCCGG + Intronic
1057340306 9:94195234-94195256 TACAGGCATGAGCCACCACATGG - Intergenic
1057345813 9:94249565-94249587 TACAGGCATGAGCCACCATGTGG - Intergenic
1057374123 9:94503207-94503229 TACAGGCACGCACCACCACCAGG + Intergenic
1057474520 9:95387348-95387370 TATAGGTGTGTGCCACCACTCGG + Intergenic
1057532905 9:95869796-95869818 TATAGGCATGAGCCAGTGTCCGG + Intergenic
1057798210 9:98173028-98173050 TACAAGCGTGAGCCACCACCTGG - Intronic
1058099886 9:100907391-100907413 TATAGGCATGAGCCACTGCCAGG + Intergenic
1058122654 9:101155873-101155895 TACAGGCATGAGCCACTGGCTGG + Intronic
1058229053 9:102403688-102403710 AACAGGCATCAGCAACCACCAGG + Intergenic
1058378000 9:104347140-104347162 TACAGGCATGAGCCACCGCCCGG - Intergenic
1058494618 9:105542729-105542751 TACAGGCATGAGCCACTGCCTGG + Intronic
1058496162 9:105561128-105561150 TATAGGCATGAGACACTGTCCGG - Intronic
1058587865 9:106530007-106530029 TACAGGTGTGTGCCACCACCAGG - Intergenic
1058642736 9:107103049-107103071 TACAGGCTTGAGCCACCGCGCGG - Intergenic
1059119231 9:111627176-111627198 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1059181205 9:112214261-112214283 TACAGGCATGAGCCACCACCTGG - Intergenic
1059244527 9:112838163-112838185 TACAGGTATGAGCCACCACCAGG + Intronic
1059665072 9:116438667-116438689 TACAGGCGTGAGCCACCGCCCGG - Intronic
1059684267 9:116619662-116619684 TACAGGCATGTGCCACCACACGG + Intronic
1060082308 9:120661236-120661258 TACAGGCATGAGCCACTGCCTGG - Intronic
1060110545 9:120903667-120903689 GATAGGTGTGGGCCACCACCAGG + Exonic
1060175249 9:121492866-121492888 TACAGGTACAAGCCACCACCCGG - Intergenic
1060180249 9:121528762-121528784 TACAGGCATGAGCTACCTGCTGG + Intergenic
1060296307 9:122345783-122345805 TACAGGCATTAGCCACCACCTGG - Intergenic
1060379472 9:123153464-123153486 TACAGGTGTGAGCTACCACCCGG + Intronic
1060425995 9:123506306-123506328 TACAGGCGTGAGCCACTGCCTGG - Intronic
1060615404 9:125008410-125008432 TACAGGCATGAGCCACTGCCTGG + Intronic
1060641065 9:125239601-125239623 TATAGGCAGAAGCCACCGCCTGG - Intronic
1060649996 9:125317348-125317370 TACAGGCGTGAGCCACCGCCCGG - Intronic
1060656447 9:125375560-125375582 TACAGGTGTGAACCACCACCCGG - Intergenic
1060704254 9:125783560-125783582 TACAGGCATCAGCCACCACGTGG + Intronic
1060730895 9:126036355-126036377 TACAGGCATGAGCCCGCACCTGG - Intergenic
1061056969 9:128228448-128228470 TATAGGCATGAGCCACCATCTGG + Intronic
1061328412 9:129877929-129877951 TACAGGTGTGTGCCACCACCTGG - Intronic
1061353214 9:130082618-130082640 TATAGGCACCTGCCACCACGTGG + Intronic
1061470039 9:130816979-130817001 TACAGGCGTGAGCCACCGCCTGG + Intronic
1061547808 9:131314933-131314955 TACAGGCATGAGCCCGCTCCAGG + Intergenic
1061595564 9:131626823-131626845 TACAGGCGTGAGCCACCGCGTGG - Intronic
1061699473 9:132405160-132405182 TACAGGCGTGAGCCACCCACTGG + Intronic
1062322977 9:135999397-135999419 TACAGGCATGAGCCACCGGCCGG + Intergenic
1062337157 9:136076731-136076753 TACAGGCATGAGCCACCACCAGG - Intronic
1203576546 Un_KI270745v1:12905-12927 TCGAGGCATGTGCCACCACAAGG + Intergenic
1203581554 Un_KI270746v1:10968-10990 TACAAGCATGAGCCACCATATGG + Intergenic
1185451470 X:283156-283178 TACAGGCGTGAGCCACTGCCCGG - Intronic
1185489229 X:508140-508162 GACAGGCATGAGCCACCACTCGG + Intergenic
1185727359 X:2432846-2432868 TACAGGCATGAGCCACTGCCCGG - Intronic
1185907200 X:3946457-3946479 TATAGGCGTGAGCCACTGCCCGG + Intergenic
1186083872 X:5964792-5964814 TACAGGCATATGCCACCACCTGG + Intronic
1186208976 X:7230161-7230183 TACAGACATGAGCCACCACCAGG + Intronic
1187159327 X:16749771-16749793 TACAGGCACACGCCACCACCCGG - Intronic
1187323278 X:18261271-18261293 TATAGGCATGCGCCACTGCCTGG + Intronic
1187342032 X:18429911-18429933 TACAGGCATGAGCCACCGCCAGG + Intronic
1187387863 X:18864657-18864679 TACAGGGAAGAGCCACCGCCTGG + Intergenic
1187612620 X:20959099-20959121 TACAGGCGCAAGCCACCACCCGG - Intergenic
1187951940 X:24479642-24479664 TACAGGCACGTGCCACCGCCTGG - Intronic
1188315619 X:28669476-28669498 TACAGGCATGCGCCACCACAAGG - Intronic
1188400537 X:29738713-29738735 TACAAGTGTGAGCCACCACCTGG + Intronic
1189509356 X:41646496-41646518 TAAAGGCATTACCCACCCCCAGG + Intronic
1189810786 X:44778941-44778963 TACAAGCATGAGCCACCAGGTGG + Intergenic
1189981994 X:46520256-46520278 TACAGGCACCCGCCACCACCTGG - Intronic
1190026407 X:46927670-46927692 TACAGGTGGGAGCCACCACCTGG + Intronic
1190112330 X:47600330-47600352 TATAGGCGTGTGCCACCATGTGG + Intronic
1190311389 X:49119382-49119404 TACAGGCATGAGCCACTACCTGG + Intronic
1190314160 X:49138957-49138979 TATAGGCATGAGTCACCACGTGG + Intergenic
1190315935 X:49151020-49151042 TACAGGCGTGTGCCACCGCCCGG + Intergenic
1190328823 X:49223327-49223349 TACAGGCGTGAGCCACCACAGGG - Intronic
1190692409 X:52922197-52922219 TACAAGCGTGAGCCACCGCCCGG + Intergenic
1190715182 X:53096990-53097012 TACAGGCATGTGCCACCATGTGG - Intergenic
1192200901 X:69066176-69066198 TCTAGGCAGGAGCTCCCACCTGG + Intergenic
1192357348 X:70416609-70416631 TACTGGCATGAGCCACCGCACGG + Intronic
1192448702 X:71229250-71229272 TACAGGCGTGCGCCACCACACGG - Intergenic
1192472514 X:71411355-71411377 TACAGGCATGAGCCACCACTAGG + Intronic
1192838282 X:74825826-74825848 TACAGGTGTGAGCCACCACCCGG + Intronic
1194645938 X:96458398-96458420 TACAGGCATGAGCCACTTGCTGG - Intergenic
1194711912 X:97245686-97245708 TACAGGCATGAGCCCCCATGTGG + Intronic
1194773490 X:97933773-97933795 TACATGCATGAGCTACCACCAGG + Intergenic
1195081295 X:101373764-101373786 TACAGGCGTGAGCCACCCACTGG - Intronic
1196423662 X:115547647-115547669 TACAGGCGTGAGCCACCTACTGG + Intergenic
1196524861 X:116719999-116720021 TACAGGCATGAGCCACCACGTGG + Intergenic
1196843257 X:119878189-119878211 TACAGGTGTGAGCCACCGCCCGG - Intergenic
1196912736 X:120500354-120500376 TATAGCCGTGAGCCACCGCCCGG - Intergenic
1197104691 X:122700351-122700373 TACAGGCGTGAGCCACCGCCTGG - Intergenic
1197676124 X:129332542-129332564 TATAGGCACGTGCCACTACCCGG + Intergenic
1197742712 X:129907679-129907701 TACAGGCATGAGCCATCACCCGG - Intronic
1198009459 X:132536083-132536105 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1198041926 X:132861066-132861088 TACAGGCATGAGCCACCACCTGG + Intronic
1198845034 X:140901341-140901363 TACAGGTGTGAGCCACCGCCTGG - Intergenic
1198892899 X:141419277-141419299 TACAGGTATGAGCCACCATGCGG - Intergenic
1198985089 X:142442117-142442139 TACATGCACGAACCACCACCTGG + Intergenic
1198985119 X:142442435-142442457 TACATGCACGAACCACCACCTGG + Intergenic
1200259531 X:154605560-154605582 TACAGGTATGAGCCACCTCGGGG - Intergenic
1200410264 Y:2853971-2853993 TACAGGCATGTGCCACCACCCGG + Intronic
1201349523 Y:13024044-13024066 TATAGGCATGAGCCACTGCCAGG - Intergenic
1201390869 Y:13496120-13496142 TACAGGCATGCGCCACCACCTGG + Intergenic