ID: 989189444

View in Genome Browser
Species Human (GRCh38)
Location 5:38655713-38655735
Sequence TTAACTCAGTCTAGCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989189444_989189447 9 Left 989189444 5:38655713-38655735 CCAGAGAAGCTAGACTGAGTTAA No data
Right 989189447 5:38655745-38655767 CCATACTTCTTTCTATGGAATGG No data
989189444_989189445 4 Left 989189444 5:38655713-38655735 CCAGAGAAGCTAGACTGAGTTAA No data
Right 989189445 5:38655740-38655762 TTGATCCATACTTCTTTCTATGG No data
989189444_989189448 15 Left 989189444 5:38655713-38655735 CCAGAGAAGCTAGACTGAGTTAA No data
Right 989189448 5:38655751-38655773 TTCTTTCTATGGAATGGTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989189444 Original CRISPR TTAACTCAGTCTAGCTTCTC TGG (reversed) Intergenic
No off target data available for this crispr