ID: 989196178

View in Genome Browser
Species Human (GRCh38)
Location 5:38718785-38718807
Sequence ACTTTCTCCCAGGAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989196178_989196186 26 Left 989196178 5:38718785-38718807 CCCTGCCCCTCCTGGGAGAAAGT No data
Right 989196186 5:38718834-38718856 CAGGCTGAGATACTTACTTCTGG No data
989196178_989196185 7 Left 989196178 5:38718785-38718807 CCCTGCCCCTCCTGGGAGAAAGT No data
Right 989196185 5:38718815-38718837 AAAAGTGTTTGTGAAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989196178 Original CRISPR ACTTTCTCCCAGGAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr