ID: 989196753

View in Genome Browser
Species Human (GRCh38)
Location 5:38723900-38723922
Sequence TTTATAAGCTACCCCGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989196753_989196756 13 Left 989196753 5:38723900-38723922 CCATAGACGGGGTAGCTTATAAA No data
Right 989196756 5:38723936-38723958 TTTTTCACAGTTCTGGAGGCTGG 0: 142
1: 1783
2: 4485
3: 6123
4: 5925
989196753_989196759 29 Left 989196753 5:38723900-38723922 CCATAGACGGGGTAGCTTATAAA No data
Right 989196759 5:38723952-38723974 AGGCTGGAGGTCCACGATTAGGG No data
989196753_989196758 28 Left 989196753 5:38723900-38723922 CCATAGACGGGGTAGCTTATAAA No data
Right 989196758 5:38723951-38723973 GAGGCTGGAGGTCCACGATTAGG No data
989196753_989196757 16 Left 989196753 5:38723900-38723922 CCATAGACGGGGTAGCTTATAAA No data
Right 989196757 5:38723939-38723961 TTCACAGTTCTGGAGGCTGGAGG No data
989196753_989196754 6 Left 989196753 5:38723900-38723922 CCATAGACGGGGTAGCTTATAAA No data
Right 989196754 5:38723929-38723951 AGATTTATTTTTCACAGTTCTGG 0: 3
1: 195
2: 1862
3: 3806
4: 5204
989196753_989196755 9 Left 989196753 5:38723900-38723922 CCATAGACGGGGTAGCTTATAAA No data
Right 989196755 5:38723932-38723954 TTTATTTTTCACAGTTCTGGAGG 0: 115
1: 1420
2: 3347
3: 5203
4: 7343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989196753 Original CRISPR TTTATAAGCTACCCCGTCTA TGG (reversed) Intergenic
No off target data available for this crispr