ID: 989196758

View in Genome Browser
Species Human (GRCh38)
Location 5:38723951-38723973
Sequence GAGGCTGGAGGTCCACGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989196753_989196758 28 Left 989196753 5:38723900-38723922 CCATAGACGGGGTAGCTTATAAA No data
Right 989196758 5:38723951-38723973 GAGGCTGGAGGTCCACGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989196758 Original CRISPR GAGGCTGGAGGTCCACGATT AGG Intergenic
No off target data available for this crispr