ID: 989201634

View in Genome Browser
Species Human (GRCh38)
Location 5:38770007-38770029
Sequence GACACTAGGGCTCTTCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989201634_989201644 10 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data
989201634_989201643 9 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201643 5:38770039-38770061 ACAGATGGGGCACCAAAGGGTGG No data
989201634_989201638 -6 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201638 5:38770024-38770046 AGTGTCTCTGAGCTCACAGATGG No data
989201634_989201639 -5 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201634_989201642 6 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201642 5:38770036-38770058 CTCACAGATGGGGCACCAAAGGG No data
989201634_989201640 -4 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201640 5:38770026-38770048 TGTCTCTGAGCTCACAGATGGGG No data
989201634_989201641 5 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201641 5:38770035-38770057 GCTCACAGATGGGGCACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989201634 Original CRISPR GACACTAGGGCTCTTCTCAC GGG (reversed) Intergenic
No off target data available for this crispr