ID: 989201639

View in Genome Browser
Species Human (GRCh38)
Location 5:38770025-38770047
Sequence GTGTCTCTGAGCTCACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989201634_989201639 -5 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201631_989201639 15 Left 989201631 5:38769987-38770009 CCACCCAGCTAAAACACAGACCC No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201632_989201639 12 Left 989201632 5:38769990-38770012 CCCAGCTAAAACACAGACCCGTG No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201629_989201639 17 Left 989201629 5:38769985-38770007 CCCCACCCAGCTAAAACACAGAC No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201633_989201639 11 Left 989201633 5:38769991-38770013 CCAGCTAAAACACAGACCCGTGA No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201628_989201639 18 Left 989201628 5:38769984-38770006 CCCCCACCCAGCTAAAACACAGA No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201630_989201639 16 Left 989201630 5:38769986-38770008 CCCACCCAGCTAAAACACAGACC No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data
989201635_989201639 -6 Left 989201635 5:38770008-38770030 CCGTGAGAAGAGCCCTAGTGTCT No data
Right 989201639 5:38770025-38770047 GTGTCTCTGAGCTCACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989201639 Original CRISPR GTGTCTCTGAGCTCACAGAT GGG Intergenic
No off target data available for this crispr