ID: 989201644

View in Genome Browser
Species Human (GRCh38)
Location 5:38770040-38770062
Sequence CAGATGGGGCACCAAAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989201634_989201644 10 Left 989201634 5:38770007-38770029 CCCGTGAGAAGAGCCCTAGTGTC No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data
989201635_989201644 9 Left 989201635 5:38770008-38770030 CCGTGAGAAGAGCCCTAGTGTCT No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data
989201636_989201644 -3 Left 989201636 5:38770020-38770042 CCCTAGTGTCTCTGAGCTCACAG No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data
989201633_989201644 26 Left 989201633 5:38769991-38770013 CCAGCTAAAACACAGACCCGTGA No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data
989201637_989201644 -4 Left 989201637 5:38770021-38770043 CCTAGTGTCTCTGAGCTCACAGA No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data
989201632_989201644 27 Left 989201632 5:38769990-38770012 CCCAGCTAAAACACAGACCCGTG No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data
989201631_989201644 30 Left 989201631 5:38769987-38770009 CCACCCAGCTAAAACACAGACCC No data
Right 989201644 5:38770040-38770062 CAGATGGGGCACCAAAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989201644 Original CRISPR CAGATGGGGCACCAAAGGGT GGG Intergenic
No off target data available for this crispr